Incidental Mutation 'R0744:Rapsn'
ID70819
Institutional Source Beutler Lab
Gene Symbol Rapsn
Ensembl Gene ENSMUSG00000002104
Gene Namereceptor-associated protein of the synapse
SynonymsNraps, rapsyn, 43kDa acetylcholine receptor-associated protein, Raps
MMRRC Submission 038925-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0744 (G1)
Quality Score138
Status Validated
Chromosome2
Chromosomal Location91035620-91045729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91036808 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 152 (Y152H)
Ref Sequence ENSEMBL: ENSMUSP00000107073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050323] [ENSMUST00000111445] [ENSMUST00000111446]
Predicted Effect probably damaging
Transcript: ENSMUST00000050323
AA Change: Y152H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054150
Gene: ENSMUSG00000002104
AA Change: Y152H

DomainStartEndE-ValueType
TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 2e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
TPR 163 196 8.29e0 SMART
TPR 206 239 1.24e0 SMART
Blast:TPR 246 279 1e-14 BLAST
TPR 286 319 2.07e1 SMART
RING 363 402 2.67e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111445
AA Change: Y152H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107072
Gene: ENSMUSG00000002104
AA Change: Y152H

DomainStartEndE-ValueType
TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 1e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
TPR 163 196 8.29e0 SMART
TPR 206 239 1.24e0 SMART
RING 304 343 2.67e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111446
AA Change: Y152H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107073
Gene: ENSMUSG00000002104
AA Change: Y152H

DomainStartEndE-ValueType
TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 1e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
Blast:TPR 193 226 9e-15 BLAST
TPR 233 266 2.07e1 SMART
RING 310 349 2.67e-5 SMART
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are receptor associated proteins of the synapse. The encoded protein contains a conserved cAMP-dependent protein kinase phosphorylation site, and plays a critical role in clustering and anchoring nicotinic acetylcholine receptors at synaptic sites by linking the receptors to the underlying postsynaptic cytoskeleton, possibly by direct association with actin or spectrin. Mutations in this gene may play a role in postsynaptic congenital myasthenic syndromes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit absence of acetylcholine receptor clusters at end plate band of neuromuscular synapses, muscle weakness, and respiratory distress leading to lethality within hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aebp2 T G 6: 140,642,364 probably null Het
AI987944 T C 7: 41,376,859 Y6C probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Baiap2l1 T A 5: 144,266,641 D479V probably benign Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
Dmxl1 T C 18: 49,833,148 V20A probably damaging Het
Dzip3 A G 16: 48,959,675 Y301H probably damaging Het
Ephb4 T A 5: 137,365,667 N600K probably damaging Het
Erich6 T A 3: 58,636,122 probably benign Het
Fbn1 T C 2: 125,314,814 probably benign Het
Fryl A T 5: 73,089,081 probably benign Het
Galnt17 T A 5: 131,150,916 D131V probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Gm6619 T A 6: 131,490,334 L54Q probably damaging Het
Herc2 T C 7: 56,206,036 probably benign Het
Hic1 T A 11: 75,165,801 Q754L possibly damaging Het
Hnf4g A T 3: 3,651,629 D286V possibly damaging Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Itih1 A T 14: 30,941,555 V164E probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc58 A G 16: 37,878,573 probably benign Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mark1 T A 1: 184,921,608 I166F probably damaging Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mast4 C G 13: 102,737,387 Q1632H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mgst3 A G 1: 167,373,805 Y104H probably damaging Het
Mlxipl C T 5: 135,132,475 T416I possibly damaging Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Muc1 C A 3: 89,230,328 P159Q possibly damaging Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Myt1 TGAGGAGGAGGAGGAGGAGG TGAGGAGGAGGAGGAGG 2: 181,797,505 probably benign Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr329-ps T A 11: 58,543,162 M105L possibly damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Pzp A G 6: 128,516,195 probably benign Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapgef3 G A 15: 97,761,585 probably benign Het
Rgs11 T A 17: 26,203,318 M29K probably damaging Het
Rictor A G 15: 6,764,278 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rims1 T C 1: 22,427,459 probably null Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Slc6a13 T G 6: 121,302,867 W67G probably damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Supt20 T A 3: 54,714,701 Y409N probably damaging Het
Synrg C T 11: 84,024,305 Q1046* probably null Het
Tab2 T C 10: 7,907,581 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Tgm6 T C 2: 130,151,761 V640A probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tnfaip3 C A 10: 19,002,949 A704S probably benign Het
Tomm34 T C 2: 164,070,976 N22D probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Trim62 A G 4: 128,884,215 S16G probably damaging Het
Ttc28 T A 5: 111,231,081 I1144N probably damaging Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Ush2a C T 1: 188,814,406 probably benign Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zbed5 T A 5: 129,902,272 V354E possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Rapsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rapsn APN 2 91035860 missense probably damaging 1.00
IGL01386:Rapsn APN 2 91036799 missense probably damaging 1.00
IGL01517:Rapsn APN 2 91036618 missense probably damaging 1.00
IGL01707:Rapsn APN 2 91043240 missense probably benign 0.03
IGL02322:Rapsn APN 2 91041906 missense possibly damaging 0.80
IGL02800:Rapsn APN 2 91043239 missense probably benign
rasputin UTSW 2 91035924 missense probably damaging 1.00
R0833:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R0836:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R1224:Rapsn UTSW 2 91043198 missense probably damaging 1.00
R1294:Rapsn UTSW 2 91036775 nonsense probably null
R1619:Rapsn UTSW 2 91043159 missense possibly damaging 0.84
R2891:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R2892:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R2893:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R4135:Rapsn UTSW 2 91036817 missense probably damaging 0.99
R4515:Rapsn UTSW 2 91043212 missense possibly damaging 0.91
R5689:Rapsn UTSW 2 91035924 missense probably damaging 1.00
R5860:Rapsn UTSW 2 91045514 missense probably damaging 1.00
R5953:Rapsn UTSW 2 91041963 missense probably benign 0.04
R6495:Rapsn UTSW 2 91036628 missense probably damaging 1.00
X0064:Rapsn UTSW 2 91043003 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCCTGCTCGAAAGCTACCTGAACC -3'
(R):5'- GCCAGTTTAAAACCCATGCCACCTG -3'

Sequencing Primer
(F):5'- AAGCTACCTGAACCTGGCG -3'
(R):5'- AGGTTGATGGCATTGTCTCAAAAG -3'
Posted On2013-09-30