Incidental Mutation 'R0744:Myt1'
ID70823
Institutional Source Beutler Lab
Gene Symbol Myt1
Ensembl Gene ENSMUSG00000010505
Gene Namemyelin transcription factor 1
SynonymsNZF-2a, NZF-2b, Nzf2, Nztf2
MMRRC Submission 038925-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0744 (G1)
Quality Score217
Status Validated
Chromosome2
Chromosomal Location181763332-181827797 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) TGAGGAGGAGGAGGAGGAGG to TGAGGAGGAGGAGGAGG at 181797505 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081125] [ENSMUST00000108756] [ENSMUST00000108757] [ENSMUST00000183403]
Predicted Effect probably benign
Transcript: ENSMUST00000081125
SMART Domains Protein: ENSMUSP00000079900
Gene: ENSMUSG00000010505

DomainStartEndE-ValueType
Pfam:zf-C2HC 71 99 8.7e-16 PFAM
low complexity region 155 160 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
coiled coil region 300 354 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Pfam:zf-C2HC 485 512 2.9e-14 PFAM
Pfam:zf-C2HC 529 557 4.3e-16 PFAM
Pfam:MYT1 604 660 2e-28 PFAM
Pfam:MYT1 659 835 2.3e-56 PFAM
Pfam:zf-C2HC 843 871 2e-18 PFAM
Pfam:zf-C2HC 887 915 1.9e-18 PFAM
Pfam:zf-C2HC 936 964 2.1e-16 PFAM
Pfam:zf-C2HC 989 1017 8.4e-16 PFAM
coiled coil region 1037 1109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108756
SMART Domains Protein: ENSMUSP00000104387
Gene: ENSMUSG00000010505

DomainStartEndE-ValueType
Pfam:zf-C2HC 27 57 5.1e-18 PFAM
low complexity region 113 118 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 258 312 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:zf-C2HC 441 471 5e-17 PFAM
Pfam:zf-C2HC 485 515 3.1e-18 PFAM
Pfam:MYT1 562 618 2.4e-32 PFAM
Pfam:MYT1 617 794 2e-74 PFAM
Pfam:zf-C2HC 799 829 1.9e-19 PFAM
Pfam:zf-C2HC 843 873 9.7e-20 PFAM
Pfam:zf-C2HC 892 922 2.2e-18 PFAM
Pfam:zf-C2HC 945 975 1.7e-16 PFAM
coiled coil region 995 1067 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108757
SMART Domains Protein: ENSMUSP00000104388
Gene: ENSMUSG00000010505

DomainStartEndE-ValueType
Pfam:zf-C2HC 27 57 1e-17 PFAM
low complexity region 113 118 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 258 312 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:zf-C2HC 441 471 1e-16 PFAM
Pfam:zf-C2HC 485 510 6.2e-12 PFAM
Pfam:MYT1 524 580 2.7e-32 PFAM
Pfam:MYT1 579 756 2.3e-74 PFAM
Pfam:zf-C2HC 761 791 3.8e-19 PFAM
Pfam:zf-C2HC 805 835 1.9e-19 PFAM
Pfam:zf-C2HC 854 884 4.3e-18 PFAM
Pfam:zf-C2HC 907 937 3.3e-16 PFAM
coiled coil region 957 1029 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129843
SMART Domains Protein: ENSMUSP00000115697
Gene: ENSMUSG00000010505

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Pfam:zf-C2HC 147 174 6.2e-15 PFAM
Pfam:zf-C2HC 191 219 9.2e-17 PFAM
Pfam:MYT1 266 322 7.3e-29 PFAM
Pfam:MYT1 321 497 7.2e-57 PFAM
Pfam:zf-C2HC 505 533 9.6e-19 PFAM
Pfam:zf-C2HC 554 582 4.4e-17 PFAM
Pfam:zf-C2HC 607 635 1.8e-16 PFAM
coiled coil region 654 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129856
SMART Domains Protein: ENSMUSP00000122011
Gene: ENSMUSG00000010505

DomainStartEndE-ValueType
Pfam:zf-C2HC 63 91 1.4e-16 PFAM
low complexity region 147 152 N/A INTRINSIC
Pfam:zf-C2HC 177 204 4.6e-15 PFAM
Pfam:zf-C2HC 221 249 6.7e-17 PFAM
Pfam:MYT1 296 352 5.2e-29 PFAM
Pfam:MYT1 351 527 4.5e-57 PFAM
Pfam:zf-C2HC 535 556 1.4e-13 PFAM
Pfam:zf-C2HC 556 584 3.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156190
Predicted Effect probably benign
Transcript: ENSMUST00000183403
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: This gene is a member of the myelin transcription factor 1 gene family. The encoded protein, a zinc finger DNA-binding protein, is involved in regulation of oligodendrocyte differentiation and proliferation in the developing central nervous system. The gene product has a role in remyelination through regeneration of oligodendrocyte lineage cells in response to demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth displaying improper diaphragm innervation and a failture to initiate breathing; mutant embryonic pancreata contain abnormal islet cells that express multiple hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aebp2 T G 6: 140,642,364 probably null Het
AI987944 T C 7: 41,376,859 Y6C probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Baiap2l1 T A 5: 144,266,641 D479V probably benign Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
Dmxl1 T C 18: 49,833,148 V20A probably damaging Het
Dzip3 A G 16: 48,959,675 Y301H probably damaging Het
Ephb4 T A 5: 137,365,667 N600K probably damaging Het
Erich6 T A 3: 58,636,122 probably benign Het
Fbn1 T C 2: 125,314,814 probably benign Het
Fryl A T 5: 73,089,081 probably benign Het
Galnt17 T A 5: 131,150,916 D131V probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Gm6619 T A 6: 131,490,334 L54Q probably damaging Het
Herc2 T C 7: 56,206,036 probably benign Het
Hic1 T A 11: 75,165,801 Q754L possibly damaging Het
Hnf4g A T 3: 3,651,629 D286V possibly damaging Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Itih1 A T 14: 30,941,555 V164E probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc58 A G 16: 37,878,573 probably benign Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mark1 T A 1: 184,921,608 I166F probably damaging Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mast4 C G 13: 102,737,387 Q1632H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mgst3 A G 1: 167,373,805 Y104H probably damaging Het
Mlxipl C T 5: 135,132,475 T416I possibly damaging Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Muc1 C A 3: 89,230,328 P159Q possibly damaging Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr329-ps T A 11: 58,543,162 M105L possibly damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Pzp A G 6: 128,516,195 probably benign Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapgef3 G A 15: 97,761,585 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rgs11 T A 17: 26,203,318 M29K probably damaging Het
Rictor A G 15: 6,764,278 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rims1 T C 1: 22,427,459 probably null Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Slc6a13 T G 6: 121,302,867 W67G probably damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Supt20 T A 3: 54,714,701 Y409N probably damaging Het
Synrg C T 11: 84,024,305 Q1046* probably null Het
Tab2 T C 10: 7,907,581 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Tgm6 T C 2: 130,151,761 V640A probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tnfaip3 C A 10: 19,002,949 A704S probably benign Het
Tomm34 T C 2: 164,070,976 N22D probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Trim62 A G 4: 128,884,215 S16G probably damaging Het
Ttc28 T A 5: 111,231,081 I1144N probably damaging Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Ush2a C T 1: 188,814,406 probably benign Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zbed5 T A 5: 129,902,272 V354E possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Myt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Myt1 APN 2 181801115 missense probably damaging 1.00
IGL00816:Myt1 APN 2 181807515 missense probably damaging 0.97
IGL01062:Myt1 APN 2 181797729 missense probably damaging 1.00
IGL01069:Myt1 APN 2 181825956 missense probably damaging 1.00
IGL01292:Myt1 APN 2 181805012 missense probably damaging 1.00
IGL01521:Myt1 APN 2 181825911 missense probably damaging 1.00
IGL01926:Myt1 APN 2 181821997 missense probably benign 0.00
IGL01976:Myt1 APN 2 181795739 missense probably damaging 1.00
IGL02066:Myt1 APN 2 181797189 missense probably damaging 1.00
IGL02109:Myt1 APN 2 181815617 splice site probably benign
IGL02209:Myt1 APN 2 181797234 missense probably benign 0.06
IGL02499:Myt1 APN 2 181825549 splice site probably benign
IGL03064:Myt1 APN 2 181797801 missense probably benign 0.31
IGL03394:Myt1 APN 2 181797845 missense probably damaging 1.00
PIT4366001:Myt1 UTSW 2 181825938 missense probably damaging 1.00
R0003:Myt1 UTSW 2 181801871 missense probably damaging 1.00
R0003:Myt1 UTSW 2 181801871 missense probably damaging 1.00
R0362:Myt1 UTSW 2 181763393 unclassified probably benign
R0627:Myt1 UTSW 2 181795689 missense probably benign 0.10
R0650:Myt1 UTSW 2 181782615 nonsense probably null
R0735:Myt1 UTSW 2 181807387 unclassified probably benign
R1115:Myt1 UTSW 2 181811231 nonsense probably null
R1460:Myt1 UTSW 2 181802932 missense probably damaging 1.00
R1471:Myt1 UTSW 2 181797111 missense probably benign
R1836:Myt1 UTSW 2 181797275 missense probably benign
R1905:Myt1 UTSW 2 181797756 missense probably damaging 1.00
R2007:Myt1 UTSW 2 181795759 missense probably benign
R2040:Myt1 UTSW 2 181825924 missense probably damaging 1.00
R2140:Myt1 UTSW 2 181825979 missense probably damaging 1.00
R2323:Myt1 UTSW 2 181806557 missense probably damaging 1.00
R2926:Myt1 UTSW 2 181826010 missense possibly damaging 0.93
R3895:Myt1 UTSW 2 181820070 missense probably damaging 1.00
R4093:Myt1 UTSW 2 181811398 missense probably damaging 1.00
R4649:Myt1 UTSW 2 181797414 missense probably benign
R4693:Myt1 UTSW 2 181795739 missense probably damaging 1.00
R4775:Myt1 UTSW 2 181822677 missense probably damaging 1.00
R4835:Myt1 UTSW 2 181797462 missense probably damaging 0.99
R5111:Myt1 UTSW 2 181795885 missense probably benign 0.01
R5120:Myt1 UTSW 2 181797620 missense probably benign 0.25
R5622:Myt1 UTSW 2 181797122 missense probably benign
R6457:Myt1 UTSW 2 181763425 splice site probably null
R6704:Myt1 UTSW 2 181811212 start codon destroyed probably null
R6752:Myt1 UTSW 2 181801082 missense probably damaging 1.00
R6944:Myt1 UTSW 2 181797594 missense possibly damaging 0.52
R7337:Myt1 UTSW 2 181802963 missense possibly damaging 0.71
R7362:Myt1 UTSW 2 181797240 missense probably benign 0.00
R7368:Myt1 UTSW 2 181782591 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGTTGAGCCCCACTGTTGTTCATC -3'
(R):5'- CTTGTCATCATCAGAGCGAACCTCC -3'

Sequencing Primer
(F):5'- GGTGAAAAGGACCTCTTTATACAGC -3'
(R):5'- CTCAGGTTTAGGACTAGATAGCTC -3'
Posted On2013-09-30