Incidental Mutation 'R0744:Itih1'
Institutional Source Beutler Lab
Gene Symbol Itih1
Ensembl Gene ENSMUSG00000006529
Gene Nameinter-alpha trypsin inhibitor, heavy chain 1
Synonymsinter-alpha (globulin) inhibitor, H1 polypeptide, Itih-1, Intin1
MMRRC Submission 038925-MU
Accession Numbers

Genbank: NM_008406.3; Ensembl: ENSMUST00000163118

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0744 (G1)
Quality Score225
Status Validated
Chromosomal Location30929180-30943289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30941555 bp
Amino Acid Change Valine to Glutamic Acid at position 164 (V164E)
Ref Sequence ENSEMBL: ENSMUSP00000126449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006704] [ENSMUST00000163118]
Predicted Effect probably damaging
Transcript: ENSMUST00000006704
AA Change: V168E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006704
Gene: ENSMUSG00000006529
AA Change: V168E

signal peptide 1 26 N/A INTRINSIC
VIT 34 167 6e-79 SMART
low complexity region 240 251 N/A INTRINSIC
VWA 291 472 2.1e-32 SMART
Blast:VWA 528 577 5e-21 BLAST
Pfam:ITI_HC_C 706 892 2.1e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163118
AA Change: V164E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126449
Gene: ENSMUSG00000006529
AA Change: V164E

signal peptide 1 26 N/A INTRINSIC
VIT 34 163 2.44e-80 SMART
low complexity region 236 247 N/A INTRINSIC
VWA 287 468 3.43e-30 SMART
Blast:VWA 524 573 5e-21 BLAST
Pfam:ITI_HC_C 701 888 5.3e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227938
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: This gene encodes a heavy chain of inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors. IaI proteins are protein-glycosaminoglycan-protein complexes comprised of two heavy chains and a light chain. The encoded protein covalently associates with the light chain via a chondroitin sulfate moiety. Intravenous administration of the encoded protein improved survival of mice after infection with Escherichia coli. This gene is located adjacent to two other IaI heavy chain genes. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature protein. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aebp2 T G 6: 140,642,364 probably null Het
AI987944 T C 7: 41,376,859 Y6C probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Baiap2l1 T A 5: 144,266,641 D479V probably benign Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
Dmxl1 T C 18: 49,833,148 V20A probably damaging Het
Dzip3 A G 16: 48,959,675 Y301H probably damaging Het
Ephb4 T A 5: 137,365,667 N600K probably damaging Het
Erich6 T A 3: 58,636,122 probably benign Het
Fbn1 T C 2: 125,314,814 probably benign Het
Fryl A T 5: 73,089,081 probably benign Het
Galnt17 T A 5: 131,150,916 D131V probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Gm6619 T A 6: 131,490,334 L54Q probably damaging Het
Herc2 T C 7: 56,206,036 probably benign Het
Hic1 T A 11: 75,165,801 Q754L possibly damaging Het
Hnf4g A T 3: 3,651,629 D286V possibly damaging Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc58 A G 16: 37,878,573 probably benign Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mark1 T A 1: 184,921,608 I166F probably damaging Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mast4 C G 13: 102,737,387 Q1632H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mgst3 A G 1: 167,373,805 Y104H probably damaging Het
Mlxipl C T 5: 135,132,475 T416I possibly damaging Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Muc1 C A 3: 89,230,328 P159Q possibly damaging Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Myt1 TGAGGAGGAGGAGGAGGAGG TGAGGAGGAGGAGGAGG 2: 181,797,505 probably benign Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr329-ps T A 11: 58,543,162 M105L possibly damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Pzp A G 6: 128,516,195 probably benign Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapgef3 G A 15: 97,761,585 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rgs11 T A 17: 26,203,318 M29K probably damaging Het
Rictor A G 15: 6,764,278 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rims1 T C 1: 22,427,459 probably null Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Slc6a13 T G 6: 121,302,867 W67G probably damaging Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Supt20 T A 3: 54,714,701 Y409N probably damaging Het
Synrg C T 11: 84,024,305 Q1046* probably null Het
Tab2 T C 10: 7,907,581 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Tgm6 T C 2: 130,151,761 V640A probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tnfaip3 C A 10: 19,002,949 A704S probably benign Het
Tomm34 T C 2: 164,070,976 N22D probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Trim62 A G 4: 128,884,215 S16G probably damaging Het
Ttc28 T A 5: 111,231,081 I1144N probably damaging Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Ush2a C T 1: 188,814,406 probably benign Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zbed5 T A 5: 129,902,272 V354E possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Itih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Itih1 APN 14 30929821 missense probably benign 0.26
IGL00227:Itih1 APN 14 30942889 splice site probably null
IGL00902:Itih1 APN 14 30932482 splice site probably benign
IGL02194:Itih1 APN 14 30930365 missense probably benign 0.01
IGL02221:Itih1 APN 14 30929587 missense probably damaging 1.00
IGL02292:Itih1 APN 14 30933355 splice site probably null
IGL02733:Itih1 APN 14 30936720 missense probably damaging 1.00
IGL02928:Itih1 APN 14 30937758 missense probably damaging 1.00
IGL03064:Itih1 APN 14 30941557 missense probably benign 0.09
1mM(1):Itih1 UTSW 14 30929850 missense probably damaging 1.00
R0092:Itih1 UTSW 14 30940863 splice site probably benign
R0647:Itih1 UTSW 14 30935863 missense probably damaging 1.00
R0662:Itih1 UTSW 14 30933360 missense possibly damaging 0.63
R0833:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R1070:Itih1 UTSW 14 30942456 splice site probably benign
R1397:Itih1 UTSW 14 30929905 splice site probably benign
R1797:Itih1 UTSW 14 30929899 missense probably damaging 1.00
R1898:Itih1 UTSW 14 30932287 missense probably benign
R1964:Itih1 UTSW 14 30929623 missense probably damaging 1.00
R1967:Itih1 UTSW 14 30941984 missense possibly damaging 0.67
R2086:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R2155:Itih1 UTSW 14 30938071 missense probably damaging 1.00
R2156:Itih1 UTSW 14 30933475 missense possibly damaging 0.88
R2225:Itih1 UTSW 14 30929577 missense possibly damaging 0.88
R3836:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3837:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3839:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R4388:Itih1 UTSW 14 30941555 missense possibly damaging 0.93
R4504:Itih1 UTSW 14 30935885 missense probably damaging 1.00
R4618:Itih1 UTSW 14 30929831 missense probably benign 0.33
R4682:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R4856:Itih1 UTSW 14 30936701 critical splice donor site probably null
R4886:Itih1 UTSW 14 30936701 critical splice donor site probably null
R5169:Itih1 UTSW 14 30933446 nonsense probably null
R5773:Itih1 UTSW 14 30935399 missense possibly damaging 0.89
R5875:Itih1 UTSW 14 30929530 missense probably benign
R6048:Itih1 UTSW 14 30929823 missense possibly damaging 0.89
R6077:Itih1 UTSW 14 30929876 missense possibly damaging 0.75
R6175:Itih1 UTSW 14 30931195 missense probably damaging 1.00
R6228:Itih1 UTSW 14 30931260 missense probably benign 0.00
R6664:Itih1 UTSW 14 30933436 missense probably damaging 1.00
R6675:Itih1 UTSW 14 30929841 missense possibly damaging 0.50
R7059:Itih1 UTSW 14 30931309 missense possibly damaging 0.93
R7168:Itih1 UTSW 14 30934107 missense probably null 0.98
R7408:Itih1 UTSW 14 30943160 missense probably benign 0.00
R7458:Itih1 UTSW 14 30943266 start codon destroyed probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2013-09-30