Incidental Mutation 'R0744:Dmxl1'
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene NameDmx-like 1
MMRRC Submission 038925-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R0744 (G1)
Quality Score160
Status Validated
Chromosomal Location49832670-49965473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49833148 bp
Amino Acid Change Valine to Alanine at position 20 (V20A)
Ref Sequence ENSEMBL: ENSMUSP00000045559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
Predicted Effect probably damaging
Transcript: ENSMUST00000041772
AA Change: V20A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: V20A

WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180611
AA Change: V20A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: V20A

WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aebp2 T G 6: 140,642,364 probably null Het
AI987944 T C 7: 41,376,859 Y6C probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Baiap2l1 T A 5: 144,266,641 D479V probably benign Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
Dzip3 A G 16: 48,959,675 Y301H probably damaging Het
Ephb4 T A 5: 137,365,667 N600K probably damaging Het
Erich6 T A 3: 58,636,122 probably benign Het
Fbn1 T C 2: 125,314,814 probably benign Het
Fryl A T 5: 73,089,081 probably benign Het
Galnt17 T A 5: 131,150,916 D131V probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Gm6619 T A 6: 131,490,334 L54Q probably damaging Het
Herc2 T C 7: 56,206,036 probably benign Het
Hic1 T A 11: 75,165,801 Q754L possibly damaging Het
Hnf4g A T 3: 3,651,629 D286V possibly damaging Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Itih1 A T 14: 30,941,555 V164E probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc58 A G 16: 37,878,573 probably benign Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mark1 T A 1: 184,921,608 I166F probably damaging Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mast4 C G 13: 102,737,387 Q1632H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mgst3 A G 1: 167,373,805 Y104H probably damaging Het
Mlxipl C T 5: 135,132,475 T416I possibly damaging Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Muc1 C A 3: 89,230,328 P159Q possibly damaging Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Myt1 TGAGGAGGAGGAGGAGGAGG TGAGGAGGAGGAGGAGG 2: 181,797,505 probably benign Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr329-ps T A 11: 58,543,162 M105L possibly damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Pzp A G 6: 128,516,195 probably benign Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapgef3 G A 15: 97,761,585 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rgs11 T A 17: 26,203,318 M29K probably damaging Het
Rictor A G 15: 6,764,278 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rims1 T C 1: 22,427,459 probably null Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Slc6a13 T G 6: 121,302,867 W67G probably damaging Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Supt20 T A 3: 54,714,701 Y409N probably damaging Het
Synrg C T 11: 84,024,305 Q1046* probably null Het
Tab2 T C 10: 7,907,581 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Tgm6 T C 2: 130,151,761 V640A probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tnfaip3 C A 10: 19,002,949 A704S probably benign Het
Tomm34 T C 2: 164,070,976 N22D probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Trim62 A G 4: 128,884,215 S16G probably damaging Het
Ttc28 T A 5: 111,231,081 I1144N probably damaging Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Ush2a C T 1: 188,814,406 probably benign Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zbed5 T A 5: 129,902,272 V354E possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49851467 missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49939553 missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49917668 missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49912725 missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49912751 missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49857334 missense probably benign
IGL01475:Dmxl1 APN 18 49871714 missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49920938 missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49962205 missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49863025 missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49864868 missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49878382 nonsense probably null
IGL01933:Dmxl1 APN 18 49877785 missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49890654 missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49894178 missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49961163 missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49877674 splice site probably benign
IGL02261:Dmxl1 APN 18 49840499 missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49864895 missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49859120 missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49878180 missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49920893 missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49864818 missense probably benign
R0001:Dmxl1 UTSW 18 49888897 splice site probably benign
R0027:Dmxl1 UTSW 18 49957295 splice site probably benign
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49955803 splice site probably benign
R0349:Dmxl1 UTSW 18 49879282 missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49879362 missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49891467 nonsense probably null
R0539:Dmxl1 UTSW 18 49857430 splice site probably benign
R0542:Dmxl1 UTSW 18 49893694 missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49935307 missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49851423 splice site probably benign
R0836:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49893402 missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49893611 missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49893225 missense probably benign
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49888853 missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49857249 missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49852367 missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49859286 critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49890767 nonsense probably null
R1646:Dmxl1 UTSW 18 49962261 missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49934637 missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49893444 nonsense probably null
R1732:Dmxl1 UTSW 18 49902988 missense probably benign
R1886:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49955914 splice site probably null
R1911:Dmxl1 UTSW 18 49878163 missense probably benign 0.00
R2020:Dmxl1 UTSW 18 49889558 nonsense probably null
R2116:Dmxl1 UTSW 18 49878817 missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49917631 missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49894094 missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49893923 missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49846639 missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49919976 splice site probably null
R2343:Dmxl1 UTSW 18 49890678 missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49880791 missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49863962 missense probably benign
R4033:Dmxl1 UTSW 18 49851431 missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49961197 missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49878017 nonsense probably null
R4406:Dmxl1 UTSW 18 49889553 missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49848761 missense probably benign
R4454:Dmxl1 UTSW 18 49893332 missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49961216 missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49962181 missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49878631 missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49878021 missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49862992 missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49851476 missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49889467 missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49957281 intron probably benign
R4885:Dmxl1 UTSW 18 49878795 missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 49895127 missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49870923 missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49893584 missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49951235 missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49863119 critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49867899 splice site probably null
R5484:Dmxl1 UTSW 18 49889464 missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49864478 missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49891626 missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49894257 missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49931941 nonsense probably null
R5706:Dmxl1 UTSW 18 49957395 critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49846586 missense probably benign
R5876:Dmxl1 UTSW 18 49870984 missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49857386 missense probably benign 0.00
R6145:Dmxl1 UTSW 18 49912766 missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 49893335 missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49863015 missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49902367 missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49871732 missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49846586 missense probably benign
R6319:Dmxl1 UTSW 18 49852300 missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49864578 missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49859179 missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49878246 missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49880780 missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49893974 missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49852288 nonsense probably null
R6857:Dmxl1 UTSW 18 49864835 missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49935305 missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49843784 critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49920902 missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49851495 missense probably null 0.99
R6897:Dmxl1 UTSW 18 49863057 missense possibly damaging 0.51
R6917:Dmxl1 UTSW 18 49864148 missense probably damaging 1.00
X0025:Dmxl1 UTSW 18 49864368 missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49919899 missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49920965 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2013-09-30