Incidental Mutation 'R0745:Palld'
ID70920
Institutional Source Beutler Lab
Gene Symbol Palld
Ensembl Gene ENSMUSG00000058056
Gene Namepalladin, cytoskeletal associated protein
Synonyms2410003B16Rik
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location61511433-61902690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61877703 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 47 (R47C)
Ref Sequence ENSEMBL: ENSMUSP00000112442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121785]
Predicted Effect probably damaging
Transcript: ENSMUST00000034057
AA Change: R47C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056
AA Change: R47C

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 667 N/A INTRINSIC
IGc2 796 865 3.1e-9 SMART
low complexity region 881 906 N/A INTRINSIC
IGc2 930 998 4.92e-12 SMART
IGc2 1029 1098 1.61e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121785
AA Change: R47C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: R47C

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 673 N/A INTRINSIC
low complexity region 687 715 N/A INTRINSIC
low complexity region 765 796 N/A INTRINSIC
low complexity region 805 840 N/A INTRINSIC
IGc2 1038 1107 3.1e-9 SMART
low complexity region 1123 1148 N/A INTRINSIC
IGc2 1172 1240 4.92e-12 SMART
IGc2 1271 1340 1.61e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133752
Meta Mutation Damage Score 0.0316 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Palld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Palld APN 8 61515935 missense possibly damaging 0.77
IGL01083:Palld APN 8 61538807 missense probably benign 0.44
IGL01644:Palld APN 8 61877478 missense probably benign 0.28
IGL01672:Palld APN 8 61877502 missense probably benign 0.22
IGL01941:Palld APN 8 61535700 missense probably benign 0.44
IGL02037:Palld APN 8 61525114 missense probably damaging 1.00
IGL02126:Palld APN 8 61877442 missense possibly damaging 0.82
IGL02537:Palld APN 8 61684934 missense probably benign 0.05
IGL02632:Palld APN 8 61515245 missense probably damaging 1.00
IGL02809:Palld APN 8 61515247 missense probably damaging 1.00
IGL02901:Palld APN 8 61876995 nonsense probably null
IGL03400:Palld APN 8 61513455 missense probably damaging 1.00
R0098:Palld UTSW 8 61525086 missense probably damaging 1.00
R0098:Palld UTSW 8 61525086 missense probably damaging 1.00
R1263:Palld UTSW 8 61513457 frame shift probably null
R1342:Palld UTSW 8 61522882 critical splice donor site probably null
R1893:Palld UTSW 8 61516621 missense probably damaging 1.00
R2017:Palld UTSW 8 61684765 missense probably damaging 0.99
R2102:Palld UTSW 8 61533433 missense possibly damaging 0.82
R2129:Palld UTSW 8 61877361 missense probably benign 0.00
R2246:Palld UTSW 8 61877135 missense probably benign 0.01
R3545:Palld UTSW 8 61550078 missense possibly damaging 0.95
R3815:Palld UTSW 8 61549837 intron probably benign
R3824:Palld UTSW 8 61709033 missense probably damaging 1.00
R4412:Palld UTSW 8 61687372 missense probably damaging 0.98
R4781:Palld UTSW 8 61877028 missense probably benign 0.01
R4836:Palld UTSW 8 61687381 missense probably benign 0.11
R4871:Palld UTSW 8 61549781 intron probably benign
R4963:Palld UTSW 8 61703210 missense probably damaging 1.00
R5036:Palld UTSW 8 61550162 missense probably damaging 1.00
R5128:Palld UTSW 8 61720588 missense probably damaging 1.00
R5343:Palld UTSW 8 61549815 intron probably benign
R5421:Palld UTSW 8 61516550 missense probably damaging 1.00
R5427:Palld UTSW 8 61550072 missense probably benign 0.01
R5561:Palld UTSW 8 61516585 missense probably damaging 1.00
R5651:Palld UTSW 8 61538788 missense probably damaging 1.00
R5679:Palld UTSW 8 61684945 missense possibly damaging 0.95
R5915:Palld UTSW 8 61533352 critical splice donor site probably null
R6153:Palld UTSW 8 61550152 missense probably damaging 1.00
R6276:Palld UTSW 8 61513423 missense probably damaging 1.00
R6323:Palld UTSW 8 61720693 missense probably damaging 1.00
R6659:Palld UTSW 8 61533443 missense probably benign 0.28
R7016:Palld UTSW 8 61515998 missense probably damaging 1.00
R7124:Palld UTSW 8 61516645 missense unknown
R7145:Palld UTSW 8 61532017 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTTCCTCGATGAAACTAGCCGCC -3'
(R):5'- AGCCTTCCTGCTACAAGCAACG -3'

Sequencing Primer
(F):5'- ATGAAACTAGCCGCCTTGTC -3'
(R):5'- CTGCTACAAGCAACGAGTGTG -3'
Posted On2013-09-30