Incidental Mutation 'R0464:Nek1'
ID71431
Institutional Source Beutler Lab
Gene Symbol Nek1
Ensembl Gene ENSMUSG00000031644
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 1
Synonymskidney, anemia and testis, kat, D8Ertd790e
MMRRC Submission 038664-MU
Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0464 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location60993195-61131346 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 61072273 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]
Predicted Effect probably benign
Transcript: ENSMUST00000034065
SMART Domains Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 556 592 N/A INTRINSIC
coiled coil region 647 685 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120689
SMART Domains Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 487 510 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
coiled coil region 584 620 N/A INTRINSIC
coiled coil region 675 713 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
low complexity region 1158 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142601
SMART Domains Protein: ENSMUSP00000121479
Gene: ENSMUSG00000031644

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
coiled coil region 162 198 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209845
Predicted Effect probably benign
Transcript: ENSMUST00000211256
Predicted Effect probably benign
Transcript: ENSMUST00000211672
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (80/80)
MGI Phenotype Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,437 L28P probably damaging Het
Ada G T 2: 163,732,964 Y84* probably null Het
Adar T A 3: 89,735,582 C257S possibly damaging Het
Adgrd1 G T 5: 129,162,650 C507F probably damaging Het
Atp5a1 T C 18: 77,779,922 Y299H probably benign Het
Bok G T 1: 93,694,213 R77L probably damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Ceacam1 A G 7: 25,472,017 S341P possibly damaging Het
Cfhr3 A T 1: 139,593,945 noncoding transcript Het
Ckap5 A G 2: 91,579,513 I947V probably benign Het
Clec2i T C 6: 128,895,423 Y173H probably damaging Het
Cttnbp2 T C 6: 18,408,691 D977G possibly damaging Het
Cyp2f2 C A 7: 27,132,537 Q406K probably benign Het
Ddx28 A G 8: 106,010,053 S458P probably damaging Het
Dppa3 T A 6: 122,628,533 probably null Het
Dusp10 C A 1: 184,069,076 L347I probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fbxl15 A T 19: 46,328,512 E13D probably benign Het
Fhit T A 14: 10,991,567 probably benign Het
Fras1 G T 5: 96,636,803 V882F probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabbr1 C T 17: 37,050,834 probably benign Het
Ganc T A 2: 120,436,694 V497D probably benign Het
Glt8d2 T G 10: 82,654,730 H242P possibly damaging Het
Gm906 A G 13: 50,248,275 probably benign Het
Gna15 T C 10: 81,512,504 Y131C probably benign Het
Gpatch8 T C 11: 102,480,886 K609E unknown Het
Gprc5a A T 6: 135,079,415 K287* probably null Het
Iqub T A 6: 24,479,263 K427* probably null Het
Itpr2 C G 6: 146,375,889 D666H probably damaging Het
Kcnj5 T C 9: 32,322,973 I15M possibly damaging Het
Kcnn2 A G 18: 45,560,359 E334G probably damaging Het
Lypd6 T A 2: 50,190,678 I126N probably damaging Het
Mtus1 T C 8: 41,002,474 D56G probably damaging Het
Myo1h A G 5: 114,360,510 D889G probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nab1 T C 1: 52,490,015 D241G possibly damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncbp3 C T 11: 73,069,821 probably benign Het
Nf1 T C 11: 79,556,789 V2452A probably benign Het
Nlrp1b A C 11: 71,218,244 S144A probably damaging Het
Npr2 A T 4: 43,640,597 probably null Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC "TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC,TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC" X: 143,743,893 probably benign Het
Paox T A 7: 140,129,282 probably benign Het
Pcdh15 T A 10: 74,626,844 probably null Het
Pde8b G A 13: 95,104,698 T202M probably damaging Het
Pigo A T 4: 43,019,814 V905D probably benign Het
Pik3cb A G 9: 99,044,743 probably null Het
Rassf5 T C 1: 131,212,261 N87S probably benign Het
Rbl1 C A 2: 157,147,545 K1051N probably damaging Het
Rfx7 T C 9: 72,618,204 V892A probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rnf144b T A 13: 47,242,887 Y233* probably null Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sbf2 T C 7: 110,464,576 probably benign Het
Sgo2a A T 1: 58,000,094 K85N probably damaging Het
Siglec1 A T 2: 131,079,359 C631S probably damaging Het
Simc1 C T 13: 54,537,100 R50* probably null Het
Skint5 T A 4: 113,535,731 M1235L unknown Het
Slc22a19 A T 19: 7,682,913 N377K probably benign Het
Spata31d1a A G 13: 59,701,759 F852L possibly damaging Het
Srbd1 G A 17: 86,120,002 S401F probably damaging Het
Stk36 C A 1: 74,611,172 Q288K probably damaging Het
Styx T C 14: 45,372,451 S191P probably benign Het
Supt6 T A 11: 78,216,338 N1214I probably benign Het
Tcim T A 8: 24,438,628 D90V probably damaging Het
Tdpoz1 T A 3: 93,671,475 M1L probably damaging Het
Tep1 T A 14: 50,847,684 T881S probably benign Het
Tlr5 C T 1: 182,973,710 A193V probably benign Het
Tmem117 T A 15: 94,714,919 F112Y probably damaging Het
Tnrc6c C T 11: 117,760,549 R1633W probably damaging Het
Trh T C 6: 92,243,668 probably null Het
Triobp A G 15: 78,966,986 R447G possibly damaging Het
Trip6 A G 5: 137,313,681 F46S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Usp33 T C 3: 152,376,235 probably benign Het
Vmn2r60 A T 7: 42,135,831 I156F probably damaging Het
Wdr17 T C 8: 54,670,392 probably benign Het
Wdr35 G T 12: 9,027,472 probably benign Het
Wwp1 C T 4: 19,638,763 probably benign Het
Zfp652 T C 11: 95,763,649 C293R probably damaging Het
Other mutations in Nek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Nek1 APN 8 61043284 missense probably benign 0.00
IGL01075:Nek1 APN 8 61124132 missense possibly damaging 0.64
IGL01122:Nek1 APN 8 61120966 missense possibly damaging 0.80
IGL01151:Nek1 APN 8 61020077 missense probably damaging 1.00
IGL01286:Nek1 APN 8 61124216 missense possibly damaging 0.64
IGL01377:Nek1 APN 8 61089456 missense probably benign
IGL01485:Nek1 APN 8 61049826 missense probably benign 0.02
IGL01688:Nek1 APN 8 61105597 nonsense probably null
IGL01806:Nek1 APN 8 61124212 missense possibly damaging 0.82
IGL02006:Nek1 APN 8 61104192 missense probably benign 0.20
IGL02304:Nek1 APN 8 61012167 missense probably damaging 1.00
IGL02659:Nek1 APN 8 61089480 missense probably benign 0.16
IGL02662:Nek1 APN 8 61104184 missense probably benign 0.00
IGL02801:Nek1 APN 8 61121061 critical splice donor site probably null
IGL02806:Nek1 APN 8 61044086 missense probably benign 0.15
IGL03037:Nek1 APN 8 61034052 missense probably benign 0.16
IGL03252:Nek1 APN 8 61072330 nonsense probably null
P0014:Nek1 UTSW 8 61071747 splice site probably benign
R0019:Nek1 UTSW 8 61089734 missense probably benign 0.01
R0403:Nek1 UTSW 8 61106855 missense probably damaging 0.99
R0726:Nek1 UTSW 8 61089592 missense probably damaging 1.00
R0761:Nek1 UTSW 8 61089455 missense probably benign
R0827:Nek1 UTSW 8 61105648 splice site probably benign
R0972:Nek1 UTSW 8 61089431 splice site probably null
R1268:Nek1 UTSW 8 61022264 missense probably damaging 1.00
R1343:Nek1 UTSW 8 61028675 missense probably damaging 1.00
R1415:Nek1 UTSW 8 61089686 missense probably benign 0.00
R1466:Nek1 UTSW 8 61125136 splice site probably benign
R1480:Nek1 UTSW 8 61124326 splice site probably null
R1526:Nek1 UTSW 8 61049941 missense probably benign 0.26
R1552:Nek1 UTSW 8 61006737 missense probably damaging 0.99
R1606:Nek1 UTSW 8 61124276 missense possibly damaging 0.82
R1650:Nek1 UTSW 8 61036076 missense probably benign 0.00
R1757:Nek1 UTSW 8 61089813 splice site probably null
R1808:Nek1 UTSW 8 61016230 missense probably damaging 1.00
R1966:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R2067:Nek1 UTSW 8 61007162 missense probably damaging 1.00
R2111:Nek1 UTSW 8 61124326 splice site probably null
R2113:Nek1 UTSW 8 61016293 missense probably damaging 1.00
R2143:Nek1 UTSW 8 61028696 missense probably damaging 1.00
R2255:Nek1 UTSW 8 61089773 missense probably damaging 1.00
R2422:Nek1 UTSW 8 61019901 missense probably damaging 1.00
R3848:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3849:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3850:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R4418:Nek1 UTSW 8 61106864 missense probably damaging 1.00
R4526:Nek1 UTSW 8 61106944 missense probably damaging 0.99
R4533:Nek1 UTSW 8 61007213 missense possibly damaging 0.95
R4544:Nek1 UTSW 8 61016304 nonsense probably null
R4677:Nek1 UTSW 8 61028806 missense probably damaging 0.99
R4739:Nek1 UTSW 8 61098511 missense probably benign 0.32
R5068:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R5421:Nek1 UTSW 8 61006677 missense possibly damaging 0.81
R5516:Nek1 UTSW 8 61089489 missense probably benign 0.03
R5855:Nek1 UTSW 8 61016272 missense probably damaging 1.00
R6125:Nek1 UTSW 8 61028701 missense probably damaging 1.00
R6267:Nek1 UTSW 8 61072309 nonsense probably null
R6292:Nek1 UTSW 8 61054736 intron probably null
R6296:Nek1 UTSW 8 61072309 nonsense probably null
R6458:Nek1 UTSW 8 61100012 missense probably benign 0.00
R6568:Nek1 UTSW 8 61106821 missense probably benign 0.00
R6629:Nek1 UTSW 8 61054333 intron probably null
R6867:Nek1 UTSW 8 61072330 missense possibly damaging 0.81
R7122:Nek1 UTSW 8 61106795 missense probably benign 0.00
R7193:Nek1 UTSW 8 61073578 missense probably damaging 0.99
R7272:Nek1 UTSW 8 61125086 missense probably benign 0.34
X0028:Nek1 UTSW 8 61043258 missense probably benign 0.19
X0066:Nek1 UTSW 8 61125128 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACATGCTGTGTCATAATTTTGCCCC -3'
(R):5'- AGCAGGAAAGCCTGGCAGTTTG -3'

Sequencing Primer
(F):5'- GTGTCATAATTTTGCCCCATAACTG -3'
(R):5'- AAGGTTTACTTCATCCCTACACAC -3'
Posted On2013-09-30