Incidental Mutation 'R0464:Spata31d1a'
ID71450
Institutional Source Beutler Lab
Gene Symbol Spata31d1a
Ensembl Gene ENSMUSG00000050876
Gene Namespermatogenesis associated 31 subfamily D, member 1A
Synonyms
MMRRC Submission 038664-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0464 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59699806-59710330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59701759 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 852 (F852L)
Ref Sequence ENSEMBL: ENSMUSP00000152919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066510] [ENSMUST00000224469] [ENSMUST00000224982]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066510
AA Change: F852L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128533
Gene: ENSMUSG00000050876
AA Change: F852L

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 66 150 3.7e-25 PFAM
low complexity region 196 217 N/A INTRINSIC
low complexity region 240 266 N/A INTRINSIC
Pfam:FAM75 400 772 2.9e-108 PFAM
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224469
Predicted Effect possibly damaging
Transcript: ENSMUST00000224982
AA Change: F852L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225362
Meta Mutation Damage Score 0.0948 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,437 L28P probably damaging Het
Ada G T 2: 163,732,964 Y84* probably null Het
Adar T A 3: 89,735,582 C257S possibly damaging Het
Adgrd1 G T 5: 129,162,650 C507F probably damaging Het
Atp5a1 T C 18: 77,779,922 Y299H probably benign Het
Bok G T 1: 93,694,213 R77L probably damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Ceacam1 A G 7: 25,472,017 S341P possibly damaging Het
Cfhr3 A T 1: 139,593,945 noncoding transcript Het
Ckap5 A G 2: 91,579,513 I947V probably benign Het
Clec2i T C 6: 128,895,423 Y173H probably damaging Het
Cttnbp2 T C 6: 18,408,691 D977G possibly damaging Het
Cyp2f2 C A 7: 27,132,537 Q406K probably benign Het
Ddx28 A G 8: 106,010,053 S458P probably damaging Het
Dppa3 T A 6: 122,628,533 probably null Het
Dusp10 C A 1: 184,069,076 L347I probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fbxl15 A T 19: 46,328,512 E13D probably benign Het
Fhit T A 14: 10,991,567 probably benign Het
Fras1 G T 5: 96,636,803 V882F probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabbr1 C T 17: 37,050,834 probably benign Het
Ganc T A 2: 120,436,694 V497D probably benign Het
Glt8d2 T G 10: 82,654,730 H242P possibly damaging Het
Gm906 A G 13: 50,248,275 probably benign Het
Gna15 T C 10: 81,512,504 Y131C probably benign Het
Gpatch8 T C 11: 102,480,886 K609E unknown Het
Gprc5a A T 6: 135,079,415 K287* probably null Het
Iqub T A 6: 24,479,263 K427* probably null Het
Itpr2 C G 6: 146,375,889 D666H probably damaging Het
Kcnj5 T C 9: 32,322,973 I15M possibly damaging Het
Kcnn2 A G 18: 45,560,359 E334G probably damaging Het
Lypd6 T A 2: 50,190,678 I126N probably damaging Het
Mtus1 T C 8: 41,002,474 D56G probably damaging Het
Myo1h A G 5: 114,360,510 D889G probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nab1 T C 1: 52,490,015 D241G possibly damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncbp3 C T 11: 73,069,821 probably benign Het
Nek1 T A 8: 61,072,273 probably benign Het
Nf1 T C 11: 79,556,789 V2452A probably benign Het
Nlrp1b A C 11: 71,218,244 S144A probably damaging Het
Npr2 A T 4: 43,640,597 probably null Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC "TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC,TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC" X: 143,743,893 probably benign Het
Paox T A 7: 140,129,282 probably benign Het
Pcdh15 T A 10: 74,626,844 probably null Het
Pde8b G A 13: 95,104,698 T202M probably damaging Het
Pigo A T 4: 43,019,814 V905D probably benign Het
Pik3cb A G 9: 99,044,743 probably null Het
Rassf5 T C 1: 131,212,261 N87S probably benign Het
Rbl1 C A 2: 157,147,545 K1051N probably damaging Het
Rfx7 T C 9: 72,618,204 V892A probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rnf144b T A 13: 47,242,887 Y233* probably null Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sbf2 T C 7: 110,464,576 probably benign Het
Sgo2a A T 1: 58,000,094 K85N probably damaging Het
Siglec1 A T 2: 131,079,359 C631S probably damaging Het
Simc1 C T 13: 54,537,100 R50* probably null Het
Skint5 T A 4: 113,535,731 M1235L unknown Het
Slc22a19 A T 19: 7,682,913 N377K probably benign Het
Srbd1 G A 17: 86,120,002 S401F probably damaging Het
Stk36 C A 1: 74,611,172 Q288K probably damaging Het
Styx T C 14: 45,372,451 S191P probably benign Het
Supt6 T A 11: 78,216,338 N1214I probably benign Het
Tcim T A 8: 24,438,628 D90V probably damaging Het
Tdpoz1 T A 3: 93,671,475 M1L probably damaging Het
Tep1 T A 14: 50,847,684 T881S probably benign Het
Tlr5 C T 1: 182,973,710 A193V probably benign Het
Tmem117 T A 15: 94,714,919 F112Y probably damaging Het
Tnrc6c C T 11: 117,760,549 R1633W probably damaging Het
Trh T C 6: 92,243,668 probably null Het
Triobp A G 15: 78,966,986 R447G possibly damaging Het
Trip6 A G 5: 137,313,681 F46S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Usp33 T C 3: 152,376,235 probably benign Het
Vmn2r60 A T 7: 42,135,831 I156F probably damaging Het
Wdr17 T C 8: 54,670,392 probably benign Het
Wdr35 G T 12: 9,027,472 probably benign Het
Wwp1 C T 4: 19,638,763 probably benign Het
Zfp652 T C 11: 95,763,649 C293R probably damaging Het
Other mutations in Spata31d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Spata31d1a APN 13 59702185 missense probably benign 0.27
IGL01397:Spata31d1a APN 13 59701738 missense probably damaging 0.99
IGL01448:Spata31d1a APN 13 59701559 missense probably benign 0.06
IGL02715:Spata31d1a APN 13 59703735 missense probably benign 0.44
IGL02983:Spata31d1a APN 13 59703694 missense possibly damaging 0.65
IGL03224:Spata31d1a APN 13 59701026 missense possibly damaging 0.85
PIT1430001:Spata31d1a UTSW 13 59701196 missense probably benign
R0302:Spata31d1a UTSW 13 59703150 missense probably benign
R0387:Spata31d1a UTSW 13 59703501 missense probably damaging 0.99
R0606:Spata31d1a UTSW 13 59702431 missense probably benign 0.03
R0617:Spata31d1a UTSW 13 59702259 missense possibly damaging 0.53
R0691:Spata31d1a UTSW 13 59700385 missense possibly damaging 0.93
R0746:Spata31d1a UTSW 13 59702263 missense possibly damaging 0.95
R1019:Spata31d1a UTSW 13 59702368 missense probably benign
R1397:Spata31d1a UTSW 13 59705039 splice site probably benign
R1543:Spata31d1a UTSW 13 59702242 missense probably benign
R1619:Spata31d1a UTSW 13 59702433 nonsense probably null
R1799:Spata31d1a UTSW 13 59703402 missense probably benign
R1820:Spata31d1a UTSW 13 59701255 missense possibly damaging 0.86
R1885:Spata31d1a UTSW 13 59702007 missense probably damaging 0.99
R1909:Spata31d1a UTSW 13 59702695 missense probably damaging 0.99
R2012:Spata31d1a UTSW 13 59702556 missense possibly damaging 0.93
R2099:Spata31d1a UTSW 13 59706071 missense probably damaging 0.97
R2132:Spata31d1a UTSW 13 59701043 missense probably damaging 0.96
R2224:Spata31d1a UTSW 13 59703715 missense probably benign
R2225:Spata31d1a UTSW 13 59703715 missense probably benign
R2226:Spata31d1a UTSW 13 59703715 missense probably benign
R2358:Spata31d1a UTSW 13 59703888 missense probably benign 0.00
R2495:Spata31d1a UTSW 13 59701993 missense possibly damaging 0.93
R3081:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R3151:Spata31d1a UTSW 13 59701366 missense probably benign 0.06
R3971:Spata31d1a UTSW 13 59702157 missense possibly damaging 0.85
R4156:Spata31d1a UTSW 13 59705047 missense possibly damaging 0.92
R4760:Spata31d1a UTSW 13 59701645 missense probably damaging 1.00
R4767:Spata31d1a UTSW 13 59701155 missense probably benign 0.03
R4877:Spata31d1a UTSW 13 59702523 missense probably damaging 0.99
R4894:Spata31d1a UTSW 13 59701728 missense probably damaging 0.98
R4961:Spata31d1a UTSW 13 59701902 missense possibly damaging 0.86
R4990:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4991:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4992:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R5088:Spata31d1a UTSW 13 59701152 unclassified probably null
R5094:Spata31d1a UTSW 13 59705044 critical splice donor site probably null
R5330:Spata31d1a UTSW 13 59700403 missense possibly damaging 0.86
R5587:Spata31d1a UTSW 13 59702618 missense probably damaging 0.96
R5832:Spata31d1a UTSW 13 59701566 missense probably damaging 0.98
R6073:Spata31d1a UTSW 13 59702994 missense probably damaging 0.98
R6208:Spata31d1a UTSW 13 59700564 missense probably damaging 0.98
R6224:Spata31d1a UTSW 13 59706320 start gained probably benign
R6250:Spata31d1a UTSW 13 59701801 missense possibly damaging 0.93
R6359:Spata31d1a UTSW 13 59703106 missense probably benign
R6806:Spata31d1a UTSW 13 59703218 missense probably benign
R6848:Spata31d1a UTSW 13 59701963 missense possibly damaging 0.91
R6851:Spata31d1a UTSW 13 59703911 missense unknown
R6985:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R7007:Spata31d1a UTSW 13 59703634 missense probably benign
R7037:Spata31d1a UTSW 13 59700324 missense possibly damaging 0.96
R7124:Spata31d1a UTSW 13 59702487 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACTGCTGCACGTCACCTTTG -3'
(R):5'- ATTCTCGGAACATGACACAGCCTC -3'

Sequencing Primer
(F):5'- GGGCTATGCTAAGGTCTCTATCTAC -3'
(R):5'- TGGAACCATTGGCATGTGAG -3'
Posted On2013-09-30