Incidental Mutation 'R0762:Col3a1'
ID72431
Institutional Source Beutler Lab
Gene Symbol Col3a1
Ensembl Gene ENSMUSG00000026043
Gene Namecollagen, type III, alpha 1
SynonymsCol3a-1
MMRRC Submission 038942-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R0762 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location45311538-45349706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45321526 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 39 (S39P)
Ref Sequence ENSEMBL: ENSMUSP00000085192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087883]
Predicted Effect unknown
Transcript: ENSMUST00000087883
AA Change: S39P
SMART Domains Protein: ENSMUSP00000085192
Gene: ENSMUSG00000026043
AA Change: S39P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWC 33 89 2.73e-20 SMART
low complexity region 100 140 N/A INTRINSIC
low complexity region 163 227 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
internal_repeat_2 249 284 3.45e-13 PROSPERO
internal_repeat_1 250 290 1.9e-17 PROSPERO
Pfam:Collagen 293 366 7.3e-9 PFAM
low complexity region 368 419 N/A INTRINSIC
internal_repeat_4 423 476 2.52e-11 PROSPERO
internal_repeat_1 427 488 1.9e-17 PROSPERO
internal_repeat_3 427 491 7.39e-12 PROSPERO
internal_repeat_2 456 491 3.45e-13 PROSPERO
Pfam:Collagen 533 592 2.6e-11 PFAM
low complexity region 632 680 N/A INTRINSIC
low complexity region 683 776 N/A INTRINSIC
low complexity region 784 815 N/A INTRINSIC
low complexity region 818 855 N/A INTRINSIC
low complexity region 865 921 N/A INTRINSIC
low complexity region 925 950 N/A INTRINSIC
low complexity region 953 974 N/A INTRINSIC
internal_repeat_4 975 1028 2.52e-11 PROSPERO
internal_repeat_3 976 1029 7.39e-12 PROSPERO
internal_repeat_5 977 991 3.33e-5 PROSPERO
internal_repeat_5 1019 1033 3.33e-5 PROSPERO
low complexity region 1037 1058 N/A INTRINSIC
Pfam:Collagen 1076 1135 5.6e-13 PFAM
Pfam:Collagen 1136 1209 4.3e-11 PFAM
COLFI 1229 1464 5.73e-166 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189818
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 93.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type III collagen found in bone, cartilage, dentin, tendon, bone marrow stroma and other connective tissue. The encoded protein forms homotrimeric type III procollagen that undergoes proteolytic processing during fibril formation. A majority of mice lacking the encoded protein die within two days of birth but about 5% of the animals survive to adulthood. The surviving mice exhibit severe cortical malformation and experience significantly shorter lifespan. The mutant mouse named "tight skin 2" exhibiting systemic sclerosis phenotype was found to harbor a missense point mutation in this gene. A pseudogene of this gene has been defined on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Most homozygous mutants die within 48 hours after birth. Surviving mutants have reduced body size, skin lesions, enlarged intestines, and die by 6 months of age from ruptured blood vessels. Occasionally intestinal rupture also results in early death. Heterozygotes exhibit tight skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,218,416 probably benign Het
4921504E06Rik T A 2: 19,477,856 N475I probably damaging Het
Adar T C 3: 89,739,983 probably benign Het
Aldh3b3 A T 19: 3,965,747 probably null Het
Amtn C T 5: 88,385,000 T158I possibly damaging Het
Ap1g2 A G 14: 55,100,411 probably benign Het
Arhgef3 A G 14: 27,397,627 Y318C probably damaging Het
Atg2b A C 12: 105,674,970 V69G possibly damaging Het
Bbx G A 16: 50,225,166 T236I possibly damaging Het
Bcl11b C T 12: 107,965,663 probably benign Het
Catsperg1 T C 7: 29,189,952 I794V probably benign Het
Ccdc88a C T 11: 29,463,112 probably benign Het
Cdhr3 C A 12: 33,060,301 R328L probably benign Het
Ces2e T A 8: 104,929,864 M242K probably damaging Het
Col12a1 A G 9: 79,681,374 probably benign Het
Cyp2a5 T A 7: 26,838,873 Y220* probably null Het
D3Ertd254e G A 3: 36,165,867 D680N possibly damaging Het
Dcc T A 18: 71,342,705 probably benign Het
Dnajb8 A G 6: 88,223,054 T191A probably damaging Het
Ephx2 A T 14: 66,102,179 F199I probably damaging Het
Fancd2 A G 6: 113,574,658 K1062E probably benign Het
Fbxo33 A G 12: 59,204,499 V410A probably benign Het
Gars T G 6: 55,077,580 probably null Het
Git1 A C 11: 77,499,834 D132A possibly damaging Het
Gm853 A G 4: 130,221,624 S44P probably damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gucy1a1 T C 3: 82,094,896 T44A unknown Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifnlr1 A G 4: 135,701,329 K156E possibly damaging Het
Klf13 T C 7: 63,891,623 N15S probably benign Het
Krt77 T C 15: 101,861,126 probably null Het
Map4 C A 9: 110,038,478 probably benign Het
Mthfr T C 4: 148,055,443 I623T possibly damaging Het
Myo7b T A 18: 31,983,944 T908S probably benign Het
Nbeal2 T G 9: 110,643,808 probably benign Het
Nwd2 T G 5: 63,800,414 F362L probably benign Het
Pcm1 A T 8: 41,261,020 R208W probably damaging Het
Pkd2l1 T C 19: 44,150,470 D647G probably benign Het
Plbd1 C T 6: 136,641,147 V24M probably damaging Het
Polr2a G A 11: 69,735,117 P1698S unknown Het
Prss12 T C 3: 123,485,504 I410T probably damaging Het
Ptpre A G 7: 135,679,235 N565S probably damaging Het
Rab44 T C 17: 29,145,270 L606P unknown Het
Rbm10 C T X: 20,637,664 probably benign Het
Rhd C T 4: 134,876,301 probably benign Het
Rspo3 T A 10: 29,499,921 probably benign Het
Sdccag8 T A 1: 176,946,144 N555K probably benign Het
Skint6 T A 4: 112,865,651 probably benign Het
Slc22a20 G A 19: 5,986,008 P45S probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Spats2l T C 1: 57,885,884 L127P possibly damaging Het
Taar8a T A 10: 24,077,077 I193N probably benign Het
Ten1 C T 11: 116,216,684 probably benign Het
Tfb2m T C 1: 179,545,833 E100G probably damaging Het
Tom1 C T 8: 75,052,306 probably benign Het
Vps52 G T 17: 33,960,011 R171L probably damaging Het
Zcwpw2 A T 9: 118,014,114 noncoding transcript Het
Zfhx4 G A 3: 5,403,820 E3013K probably damaging Het
Zfp777 C T 6: 48,029,360 V411M probably damaging Het
Other mutations in Col3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Col3a1 APN 1 45347135 missense probably damaging 1.00
IGL00928:Col3a1 APN 1 45340858 intron probably benign
IGL00958:Col3a1 APN 1 45327595 missense unknown
IGL01353:Col3a1 APN 1 45333638 unclassified probably benign
IGL01820:Col3a1 APN 1 45321608 missense unknown
IGL01839:Col3a1 APN 1 45311830 missense unknown
IGL02517:Col3a1 APN 1 45325803 critical splice acceptor site probably null
IGL02879:Col3a1 APN 1 45340959 intron probably benign
IGL02960:Col3a1 APN 1 45328455 missense unknown
IGL03245:Col3a1 APN 1 45331109 unclassified probably benign
IGL03308:Col3a1 APN 1 45330617 splice site probably benign
Kraken UTSW 1 45327866 splice site probably null
IGL03050:Col3a1 UTSW 1 45328925 splice site probably null
PIT4520001:Col3a1 UTSW 1 45335783 critical splice donor site probably null
R0063:Col3a1 UTSW 1 45330541 splice site probably benign
R0122:Col3a1 UTSW 1 45340897 intron probably benign
R0131:Col3a1 UTSW 1 45328868 splice site probably benign
R0765:Col3a1 UTSW 1 45336651 unclassified probably benign
R0853:Col3a1 UTSW 1 45343324 intron probably benign
R0898:Col3a1 UTSW 1 45333993 unclassified probably benign
R1170:Col3a1 UTSW 1 45327601 missense unknown
R1170:Col3a1 UTSW 1 45347724 missense probably damaging 1.00
R1440:Col3a1 UTSW 1 45343312 splice site probably null
R1449:Col3a1 UTSW 1 45321611 missense unknown
R1526:Col3a1 UTSW 1 45321688 missense unknown
R1572:Col3a1 UTSW 1 45345968 missense possibly damaging 0.95
R1585:Col3a1 UTSW 1 45327866 splice site probably null
R1616:Col3a1 UTSW 1 45328488 critical splice donor site probably null
R1691:Col3a1 UTSW 1 45348616 unclassified probably benign
R1876:Col3a1 UTSW 1 45342235 splice site probably null
R1937:Col3a1 UTSW 1 45334293 unclassified probably benign
R2093:Col3a1 UTSW 1 45332990 missense probably damaging 1.00
R2110:Col3a1 UTSW 1 45330145 missense unknown
R2119:Col3a1 UTSW 1 45346121 missense probably damaging 1.00
R2256:Col3a1 UTSW 1 45321632 missense unknown
R2327:Col3a1 UTSW 1 45338611 unclassified probably benign
R2518:Col3a1 UTSW 1 45337512 unclassified probably benign
R2991:Col3a1 UTSW 1 45335779 unclassified probably benign
R3405:Col3a1 UTSW 1 45338753 unclassified probably benign
R3784:Col3a1 UTSW 1 45347135 missense probably damaging 1.00
R3847:Col3a1 UTSW 1 45321990 missense unknown
R3848:Col3a1 UTSW 1 45321990 missense unknown
R3849:Col3a1 UTSW 1 45321990 missense unknown
R4502:Col3a1 UTSW 1 45348677 unclassified probably benign
R4503:Col3a1 UTSW 1 45348677 unclassified probably benign
R4764:Col3a1 UTSW 1 45346110 missense probably damaging 1.00
R4839:Col3a1 UTSW 1 45323803 splice site probably null
R4934:Col3a1 UTSW 1 45339952 unclassified probably benign
R5033:Col3a1 UTSW 1 45346110 missense probably damaging 1.00
R5123:Col3a1 UTSW 1 45333596 unclassified probably benign
R5190:Col3a1 UTSW 1 45329084 missense unknown
R5190:Col3a1 UTSW 1 45344807 intron probably benign
R5375:Col3a1 UTSW 1 45347899 unclassified probably null
R5407:Col3a1 UTSW 1 45346052 missense probably benign 0.03
R5627:Col3a1 UTSW 1 45331560 unclassified probably benign
R5642:Col3a1 UTSW 1 45331712 unclassified probably benign
R6014:Col3a1 UTSW 1 45321579 nonsense probably null
R6052:Col3a1 UTSW 1 45345013 unclassified probably benign
R6263:Col3a1 UTSW 1 45321575 missense unknown
R6453:Col3a1 UTSW 1 45339378 unclassified probably benign
R6463:Col3a1 UTSW 1 45342205 intron probably benign
R6488:Col3a1 UTSW 1 45331534 unclassified probably benign
R6525:Col3a1 UTSW 1 45347179 missense possibly damaging 0.88
R6637:Col3a1 UTSW 1 45347730 missense probably damaging 1.00
R6704:Col3a1 UTSW 1 45347732 missense probably damaging 1.00
R6744:Col3a1 UTSW 1 45338622 unclassified probably benign
R6745:Col3a1 UTSW 1 45338622 unclassified probably benign
R6747:Col3a1 UTSW 1 45338622 unclassified probably benign
R6858:Col3a1 UTSW 1 45345984 missense probably damaging 1.00
R6903:Col3a1 UTSW 1 45331988 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCACTAATGTCCAACAGAGTGAGC -3'
(R):5'- ACAGACTCACAGGTGTAGAAGGCTG -3'

Sequencing Primer
(F):5'- GGGTAAAACTGTTCATTTCCAGC -3'
(R):5'- CTGTGGGCATATTGCACAAC -3'
Posted On2013-09-30