Incidental Mutation 'R0763:Il12rb1'
ID72512
Institutional Source Beutler Lab
Gene Symbol Il12rb1
Ensembl Gene ENSMUSG00000000791
Gene Nameinterleukin 12 receptor, beta 1
SynonymsIL-12R[b], CD212
MMRRC Submission 038943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0763 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70808449-70821424 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 70813290 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000808] [ENSMUST00000212146] [ENSMUST00000212657]
Predicted Effect probably benign
Transcript: ENSMUST00000000808
SMART Domains Protein: ENSMUSP00000000808
Gene: ENSMUSG00000000791

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FN3 467 550 9.4e-7 SMART
transmembrane domain 567 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211936
Predicted Effect probably benign
Transcript: ENSMUST00000212146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212251
Predicted Effect probably benign
Transcript: ENSMUST00000212657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212826
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein that belongs to the hemopoietin receptor superfamily. This protein binds to interleukine 12 (IL12) with a low affinity, and is thought to be a part of IL12 receptor complex. This protein forms a disulfide-linked oligomer, which is required for its IL12 binding activity. The coexpression of this and IL12RB2 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. Mutations in this gene impair the development of interleukin-17-producing T lymphocytes and result in increased susceptibility to mycobacterial and Salmonella infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased serum IFN-gamma levels in response to recombinant IL-12 or LPS treatment, and failure of ConA-activated splenocytes to proliferate or secrete IFN-gamma in response to IL-12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,838,279 F290V probably damaging Het
Adam26b G A 8: 43,520,564 S467L probably damaging Het
Adgrv1 T A 13: 81,499,125 I3099F probably damaging Het
Akap6 A G 12: 53,142,214 D2137G possibly damaging Het
Arhgdig T C 17: 26,200,301 Y48C probably damaging Het
Astn1 A G 1: 158,509,890 I389V possibly damaging Het
Atp8a1 T C 5: 67,659,883 D920G probably benign Het
BC016579 T A 16: 45,629,455 N200I probably damaging Het
Casc3 T C 11: 98,831,318 Y661H probably damaging Het
Cep120 A C 18: 53,721,737 V442G probably benign Het
Cfap65 A G 1: 74,904,682 Y1557H probably damaging Het
Chd2 G T 7: 73,447,274 Q1485K possibly damaging Het
Cntrl T C 2: 35,171,066 F1967L probably benign Het
Csmd1 G A 8: 17,027,284 T119M possibly damaging Het
Dnah9 T C 11: 66,155,530 H64R probably benign Het
Ep400 T C 5: 110,665,837 R2899G probably damaging Het
Fam205a1 A G 4: 42,851,238 V306A probably damaging Het
Foxl2 A C 9: 98,956,033 T125P probably damaging Het
Foxred1 A T 9: 35,207,473 probably null Het
H2-Eb1 T A 17: 34,314,159 probably benign Het
Heatr3 T C 8: 88,158,241 S378P probably damaging Het
Hectd4 T C 5: 121,307,033 probably benign Het
Hps3 T G 3: 20,003,279 R780S probably damaging Het
Ifi44 G A 3: 151,749,498 A30V probably damaging Het
Invs G A 4: 48,392,628 G281R possibly damaging Het
Itgax C A 7: 128,147,940 probably benign Het
Jade1 G T 3: 41,613,783 C762F possibly damaging Het
Lama1 C T 17: 67,772,818 P1229S probably damaging Het
Mmp15 C A 8: 95,368,228 D243E probably benign Het
Mug2 A G 6: 122,075,294 T1004A probably benign Het
Myh14 A T 7: 44,665,367 V44E probably damaging Het
N4bp2l1 C A 5: 150,594,404 R11S possibly damaging Het
Notch4 T A 17: 34,565,332 C36* probably null Het
Nwd1 A G 8: 72,671,044 D637G probably damaging Het
Ogfod1 T C 8: 94,055,636 I238T probably benign Het
Palm2 G A 4: 57,688,441 E95K probably damaging Het
Papln A G 12: 83,791,865 D1256G possibly damaging Het
Ppp1r26 T C 2: 28,450,367 L3P probably damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc17a5 A T 9: 78,553,090 probably benign Het
Slc25a17 A G 15: 81,323,706 probably benign Het
Socs4 T C 14: 47,290,655 F349S probably damaging Het
Tchhl1 A C 3: 93,471,571 E527D probably benign Het
Tm7sf3 A G 6: 146,606,289 L425S possibly damaging Het
Tmem266 G T 9: 55,414,955 V112L probably damaging Het
Tmem30c T A 16: 57,270,176 I223F possibly damaging Het
Tomm70a G A 16: 57,122,172 G104D probably benign Het
Ttc17 G T 2: 94,332,803 A834E probably benign Het
Ttn C T 2: 76,731,190 V20664M probably damaging Het
Zbed5 T C 5: 129,902,179 V323A probably benign Het
Other mutations in Il12rb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Il12rb1 APN 8 70811187 nonsense probably null
IGL03065:Il12rb1 APN 8 70820558 missense possibly damaging 0.51
P0026:Il12rb1 UTSW 8 70812541 missense probably damaging 0.99
R0140:Il12rb1 UTSW 8 70819771 splice site probably benign
R1554:Il12rb1 UTSW 8 70813372 critical splice donor site probably null
R1577:Il12rb1 UTSW 8 70810606 missense probably damaging 0.99
R1688:Il12rb1 UTSW 8 70819402 missense probably damaging 1.00
R1918:Il12rb1 UTSW 8 70813680 missense probably benign 0.04
R2848:Il12rb1 UTSW 8 70815802 nonsense probably null
R3735:Il12rb1 UTSW 8 70817218 missense probably damaging 0.99
R4791:Il12rb1 UTSW 8 70813368 missense possibly damaging 0.83
R4857:Il12rb1 UTSW 8 70810588 missense possibly damaging 0.94
R5189:Il12rb1 UTSW 8 70811058 missense possibly damaging 0.66
R5493:Il12rb1 UTSW 8 70809839 missense probably benign 0.00
R5590:Il12rb1 UTSW 8 70813767 missense possibly damaging 0.83
R6484:Il12rb1 UTSW 8 70809704 unclassified probably null
R7213:Il12rb1 UTSW 8 70816453 missense probably benign 0.00
R7301:Il12rb1 UTSW 8 70813699 missense possibly damaging 0.73
R7388:Il12rb1 UTSW 8 70810627 missense probably damaging 1.00
X0061:Il12rb1 UTSW 8 70814635 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAGTCTCATGGTTTTCCCCAGTTC -3'
(R):5'- TGTAGATCCAGGTCACCCAACCAG -3'

Sequencing Primer
(F):5'- TGAGTCAGAGGAGCCTGACC -3'
(R):5'- GACCTTGGCTGTTGTACATATCAC -3'
Posted On2013-09-30