Incidental Mutation 'R0765:Dcc'
ID72636
Institutional Source Beutler Lab
Gene Symbol Dcc
Ensembl Gene ENSMUSG00000060534
Gene Namedeleted in colorectal carcinoma
SynonymsC030036D22Rik, Igdcc1
MMRRC Submission 038945-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0765 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location71258738-72351069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71362990 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1028 (D1028V)
Ref Sequence ENSEMBL: ENSMUSP00000073094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073379] [ENSMUST00000114943]
PDB Structure
Structure of the myosin X MyTH4-FERM/DCC complex [X-RAY DIFFRACTION]
Crystal Structure of chicken Netrin-1 (LN-LE3) in complex with mouse DCC (FN4-5) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000073379
AA Change: D1028V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073094
Gene: ENSMUSG00000060534
AA Change: D1028V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 824 909 2.48e-6 SMART
FN3 925 1011 1.35e-7 SMART
transmembrane domain 1079 1101 N/A INTRINSIC
Pfam:Neogenin_C 1126 1425 5.5e-129 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114943
AA Change: D1048V

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110593
Gene: ENSMUSG00000060534
AA Change: D1048V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 844 929 2.48e-6 SMART
FN3 945 1031 1.35e-7 SMART
transmembrane domain 1099 1121 N/A INTRINSIC
Pfam:Neogenin_C 1148 1445 3.4e-113 PFAM
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a netrin 1 receptor. The transmembrane protein is a member of the immunoglobulin superfamily of cell adhesion molecules, and mediates axon guidance of neuronal growth cones towards sources of netrin 1 ligand. The cytoplasmic tail interacts with the tyrosine kinases Src and focal adhesion kinase (FAK, also known as PTK2) to mediate axon attraction. The protein partially localizes to lipid rafts, and induces apoptosis in the absence of ligand. The protein functions as a tumor suppressor, and is frequently mutated or downregulated in colorectal cancer and esophageal carcinoma. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous animals show defects in axonal projections and hypothalamic development affecting both visual and neruoendocrine systems. Incidence of tumors increases in mutations preventing netrin-1 binding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T A 5: 107,506,934 D354E probably benign Het
Abhd16a T A 17: 35,101,851 V425D probably benign Het
Ano9 T G 7: 141,107,184 I381L probably damaging Het
Apob C T 12: 8,016,518 L4496F probably benign Het
Arhgef38 C T 3: 133,116,583 E724K probably damaging Het
Atp8b4 T A 2: 126,372,150 probably null Het
Baiap2l1 G T 5: 144,277,703 P394T probably damaging Het
Cnbp C A 6: 87,845,173 C122F probably damaging Het
Col3a1 A G 1: 45,336,651 probably benign Het
Colq T G 14: 31,526,037 D408A possibly damaging Het
Cuzd1 A T 7: 131,316,095 S259T probably benign Het
Cyp3a57 A G 5: 145,390,410 probably benign Het
Dbn1 C A 13: 55,482,294 V112F probably damaging Het
Dnajb11 T C 16: 22,862,568 V32A probably damaging Het
Dsg4 G A 18: 20,454,646 probably benign Het
Dyrk1b C T 7: 28,185,711 probably benign Het
Ebf1 T A 11: 44,869,160 M208K probably damaging Het
Efhc1 A G 1: 20,978,652 I430V probably benign Het
Elovl2 T C 13: 41,187,466 Y181C probably benign Het
Fras1 A G 5: 96,552,796 Q225R probably benign Het
Frmd3 G A 4: 74,161,767 R332Q probably damaging Het
Glg1 A G 8: 111,159,797 probably null Het
Hmcn1 G A 1: 150,808,787 T344M probably damaging Het
Il1rap T G 16: 26,710,632 probably null Het
Klra1 A T 6: 130,379,092 probably benign Het
Larp7 C A 3: 127,546,165 K289N probably damaging Het
Lgr6 C A 1: 134,993,886 G240V probably benign Het
Lrp10 G T 14: 54,468,090 D246Y probably damaging Het
Map3k20 G A 2: 72,371,925 V167I probably damaging Het
Med23 T C 10: 24,900,710 S347P probably damaging Het
Mybph T C 1: 134,197,496 V254A possibly damaging Het
Ndufv2 A G 17: 66,101,078 probably benign Het
Nuf2 A T 1: 169,522,936 probably benign Het
Nup210l T C 3: 90,119,877 Y189H probably damaging Het
Olfr1025-ps1 T C 2: 85,918,705 L260P probably damaging Het
Olfr1263 G A 2: 90,015,670 V247I probably benign Het
Olfr574 C T 7: 102,948,732 T79I probably damaging Het
Pdgfra C A 5: 75,187,987 probably benign Het
Phlpp1 T C 1: 106,392,283 L1336P probably damaging Het
Prpf38b T C 3: 108,911,418 T9A possibly damaging Het
Rnf213 G A 11: 119,423,095 probably null Het
Saal1 A T 7: 46,699,647 V281E possibly damaging Het
Slc17a3 C T 13: 23,846,896 Q186* probably null Het
Slc6a2 A G 8: 92,989,031 T266A probably damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
Srfbp1 T C 18: 52,490,435 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tesk1 C T 4: 43,446,706 P365S possibly damaging Het
Tmem127 C A 2: 127,257,149 T201K probably damaging Het
Trim17 T G 11: 58,971,369 V409G possibly damaging Het
Trim43c C T 9: 88,841,916 T165I probably benign Het
Ush2a C A 1: 188,948,574 F4916L possibly damaging Het
Vmn1r89 A G 7: 13,219,540 M68V probably benign Het
Vmn2r105 C T 17: 20,227,711 E284K probably benign Het
Vmn2r105 T C 17: 20,227,857 D235G probably damaging Het
Vmn2r-ps134 C T 17: 23,446,041 noncoding transcript Het
Zdbf2 G A 1: 63,305,723 S1087N possibly damaging Het
Zfp534 G A 4: 147,674,236 P659S probably damaging Het
Other mutations in Dcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dcc APN 18 71384225 critical splice acceptor site probably null
IGL00781:Dcc APN 18 71809195 missense probably benign 0.25
IGL00818:Dcc APN 18 71955012 missense probably benign
IGL00895:Dcc APN 18 71810800 missense probably damaging 0.98
IGL00969:Dcc APN 18 71456883 missense probably benign 0.25
IGL01019:Dcc APN 18 71809090 missense probably benign 0.00
IGL01132:Dcc APN 18 71682174 nonsense probably null
IGL01349:Dcc APN 18 71370737 missense probably damaging 1.00
IGL01355:Dcc APN 18 71809114 missense probably benign 0.00
IGL01374:Dcc APN 18 71374553 missense probably damaging 1.00
IGL01947:Dcc APN 18 71826209 missense probably benign
IGL02470:Dcc APN 18 71955082 splice site probably benign
IGL02508:Dcc APN 18 71370702 missense probably benign 0.00
IGL02999:Dcc APN 18 71378678 missense possibly damaging 0.68
IGL03034:Dcc APN 18 71575143 nonsense probably null
IGL03118:Dcc APN 18 71420273 missense probably benign 0.00
IGL03133:Dcc APN 18 71262955 splice site probably benign
IGL03357:Dcc APN 18 71327554 missense probably damaging 1.00
Hyperrev UTSW 18 71259015 missense probably damaging 1.00
LCD18:Dcc UTSW 18 72297447 intron probably benign
P0031:Dcc UTSW 18 71384228 splice site probably benign
PIT4142001:Dcc UTSW 18 71384226 splice site probably null
R0076:Dcc UTSW 18 71321046 nonsense probably null
R0355:Dcc UTSW 18 71575208 missense possibly damaging 0.75
R0370:Dcc UTSW 18 71587985 missense possibly damaging 0.92
R0383:Dcc UTSW 18 71420263 missense probably damaging 0.99
R0541:Dcc UTSW 18 71259015 missense probably damaging 1.00
R0690:Dcc UTSW 18 71809204 splice site probably benign
R0762:Dcc UTSW 18 71342705 splice site probably benign
R0846:Dcc UTSW 18 71826212 missense probably benign 0.06
R1230:Dcc UTSW 18 71682313 missense probably damaging 1.00
R1662:Dcc UTSW 18 71420338 missense probably benign 0.00
R1663:Dcc UTSW 18 71826052 missense probably damaging 1.00
R1697:Dcc UTSW 18 71370737 missense probably damaging 1.00
R1770:Dcc UTSW 18 71446399 missense probably benign 0.01
R1781:Dcc UTSW 18 71378717 missense probably benign 0.41
R1797:Dcc UTSW 18 71367161 missense probably damaging 1.00
R2101:Dcc UTSW 18 71810870 missense possibly damaging 0.62
R2190:Dcc UTSW 18 71547420 missense possibly damaging 0.89
R2248:Dcc UTSW 18 71826168 missense probably benign 0.00
R2262:Dcc UTSW 18 71374551 missense probably damaging 1.00
R2442:Dcc UTSW 18 71456883 missense probably damaging 0.98
R3844:Dcc UTSW 18 71826186 missense probably benign 0.01
R4037:Dcc UTSW 18 72350397 missense possibly damaging 0.57
R4085:Dcc UTSW 18 71826169 missense probably benign 0.00
R4344:Dcc UTSW 18 71374490 missense probably damaging 0.99
R4499:Dcc UTSW 18 71547317 missense probably benign 0.07
R4611:Dcc UTSW 18 71548998 splice site probably null
R4811:Dcc UTSW 18 71299483 missense probably benign 0.31
R4937:Dcc UTSW 18 71542249 nonsense probably null
R5125:Dcc UTSW 18 71456877 missense probably benign 0.02
R5292:Dcc UTSW 18 71306088 missense probably damaging 1.00
R5297:Dcc UTSW 18 71378738 missense probably benign 0.00
R5317:Dcc UTSW 18 71384155 missense possibly damaging 0.78
R5691:Dcc UTSW 18 71575083 missense probably damaging 1.00
R5693:Dcc UTSW 18 71575082 missense probably damaging 1.00
R6091:Dcc UTSW 18 71809114 missense probably benign 0.00
R6291:Dcc UTSW 18 71682167 missense probably benign 0.06
R6307:Dcc UTSW 18 71810755 missense probably benign 0.15
R6343:Dcc UTSW 18 71336035 missense probably damaging 1.00
R6508:Dcc UTSW 18 71306073 missense probably damaging 1.00
R6701:Dcc UTSW 18 71809120 missense probably benign 0.02
R6810:Dcc UTSW 18 71370693 missense probably damaging 0.99
R7078:Dcc UTSW 18 71547398 missense probably benign 0.05
R7172:Dcc UTSW 18 71378684 missense probably benign 0.04
W0251:Dcc UTSW 18 71826083 missense probably damaging 1.00
X0020:Dcc UTSW 18 71321100 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCACGGCAGAACTTTAATCCACAGC -3'
(R):5'- TTTGAGGGGTTTGCCACCTCTGAC -3'

Sequencing Primer
(F):5'- TTTAATCCACAGCTCAGGAAAGG -3'
(R):5'- TGCCACCTCTGACTGATTATC -3'
Posted On2013-09-30