Incidental Mutation 'R0801:Mdga2'
ID76292
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 2
SynonymsAdp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
MMRRC Submission 038981-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0801 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location66466060-67222549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66486733 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 878 (I878K)
Ref Sequence ENSEMBL: ENSMUSP00000152613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000222623] [ENSMUST00000222987] [ENSMUST00000223141]
Predicted Effect probably damaging
Transcript: ENSMUST00000037181
AA Change: I954K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: I954K

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178724
Predicted Effect unknown
Transcript: ENSMUST00000178814
AA Change: I937K
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: I937K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222167
AA Change: I885K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222623
AA Change: I226K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222736
Predicted Effect probably damaging
Transcript: ENSMUST00000222987
AA Change: I226K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000223141
AA Change: I878K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.476 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.6%
  • 20x: 94.7%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030612E09Rik A G 10: 43,174,991 K94E possibly damaging Het
Aldh16a1 A T 7: 45,147,476 C228S probably benign Het
Arnt G T 3: 95,493,846 R702L possibly damaging Het
Ccdc174 A G 6: 91,895,332 E314G possibly damaging Het
Ccdc81 T C 7: 89,887,658 probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Cenpm A T 15: 82,234,466 I149N probably benign Het
Cfap44 C T 16: 44,422,486 S751L probably benign Het
Cntrl A G 2: 35,175,095 probably benign Het
Col1a2 A G 6: 4,531,316 T762A unknown Het
Crebbp T C 16: 4,088,276 K1621E probably damaging Het
Cux1 T A 5: 136,326,929 I374L probably damaging Het
Dgkq A T 5: 108,660,720 probably null Het
Dis3l T C 9: 64,319,154 I365V probably benign Het
Dock2 T C 11: 34,708,793 R320G probably damaging Het
Dst A G 1: 34,170,389 N853S probably damaging Het
Egf T C 3: 129,702,585 probably benign Het
Eif2ak2 T A 17: 78,866,349 R267* probably null Het
Ern2 A G 7: 122,180,862 probably benign Het
Ero1lb A G 13: 12,581,687 S123G probably benign Het
Fam13a G T 6: 58,984,012 N118K probably benign Het
Gcn1l1 T A 5: 115,591,006 M792K probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Irf3 C T 7: 45,000,634 probably benign Het
Map2k5 T A 9: 63,357,979 probably benign Het
Mcf2l T A 8: 13,014,020 probably benign Het
Mdn1 T C 4: 32,668,895 S318P probably benign Het
Olfr1107 G A 2: 87,072,063 Q24* probably null Het
Olfr525 G A 7: 140,322,918 C73Y probably damaging Het
Pklr G A 3: 89,145,522 W527* probably null Het
Pnpla5 T C 15: 84,113,920 M374V probably benign Het
Ptprn G T 1: 75,252,265 H835Q probably damaging Het
R3hdm4 A G 10: 79,913,357 probably benign Het
Rgs8 T A 1: 153,670,811 C19S probably damaging Het
Smarca4 C A 9: 21,642,554 Q575K possibly damaging Het
Srgap1 A T 10: 121,807,875 F612L probably damaging Het
Svil A G 18: 5,099,443 R1256G probably benign Het
Tox4 T C 14: 52,279,878 S22P probably benign Het
Ttc39d A G 17: 80,216,215 Y101C probably damaging Het
Usb1 T C 8: 95,333,540 probably null Het
Vps13a T C 19: 16,686,656 probably benign Het
Vps26a G A 10: 62,459,078 probably benign Het
Zfp638 T A 6: 83,972,238 probably benign Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense not run
Predicted Primers PCR Primer
(F):5'- TGACTGAAGTACAAAACTTGTTTCAAATGCC -3'
(R):5'- TCACAGCATGATAGCAAGATAAGAAATTGGAT -3'

Sequencing Primer
(F):5'- acttcccaaattccaggatgac -3'
(R):5'- TCTGCAAGACTTAATTTTAGATGCTC -3'
Posted On2013-10-16