Mutagenetix > Incidental Mutation

Incidental Mutation 'R0803:Vezf1'

76311

Institutional Source

Beutler Lab

Gene Symbol

Vezf1

Ensembl Gene

ENSMUSG00000018377

Gene Name

vascular endothelial zinc finger 1

Synonyms

db1

MMRRC Submission

038983-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0803 (G1)

Quality Score

145

Status

Not validated

Chromosome

Chromosomal Location

87959105-87975555 bp(+) (GRCm39)

Type of Mutation

critical splice donor site

DNA Base Change (assembly)

A to T at 88068435 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000018521 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018521]

AlphaFold

Q5SXC4

Predicted Effect

probably benign
Transcript: ENSMUST00000018521

SMART Domains

Protein: ENSMUSP00000018521
Gene: ENSMUSG00000018377

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
ZnF_C2H2	74	96	3.83e-2	SMART
low complexity region	137	172	N/A	INTRINSIC
ZnF_C2H2	174	196	6.78e-3	SMART
ZnF_C2H2	202	224	2.99e-4	SMART
ZnF_C2H2	232	255	1.1e-2	SMART
ZnF_C2H2	261	283	3.16e-3	SMART
ZnF_C2H2	287	308	2.61e1	SMART
low complexity region	335	351	N/A	INTRINSIC
low complexity region	368	379	N/A	INTRINSIC
low complexity region	384	397	N/A	INTRINSIC
low complexity region	454	472	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152627

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153213

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156149

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 98.0%
20x: 96.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcriptional regulatory proteins containing tandemly repeated zinc finger domains are thought to be involved in both normal and abnormal cellular proliferation and differentiation. ZNF161 is a C2H2-type zinc finger protein (Koyano-Nakagawa et al., 1994 [PubMed 8035792]). See MIM 603971 for general information on zinc finger proteins.[supplied by OMIM, Sep 2008]
PHENOTYPE: Homozygous null mice die at midgestation due to angiogenic remodeling defects and loss of vascular integrity leading to hemorrhaging in the head, heart and trunk. One fifth of heterozygous null embryos show lymphatic hypervascularization associated with hemorrhaging and edema in the jugular region. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 2 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Mup21	G	A	4: 62,066,478 (GRCm39)	R141*	probably null	Het
Ugcg	C	A	4: 59,189,685 (GRCm39)	F14L	probably benign	Het

Other mutations in Vezf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Vezf1	APN	11	87,964,320 (GRCm39)	missense	probably benign	0.14
IGL00576:Vezf1	APN	11	87,964,470 (GRCm39)	nonsense	probably null
IGL02683:Vezf1	APN	11	87,967,153 (GRCm39)	missense	probably benign	0.36
IGL02700:Vezf1	APN	11	87,964,129 (GRCm39)	missense	probably damaging	0.97
IGL02701:Vezf1	APN	11	87,967,047 (GRCm39)	nonsense	probably null
R0541:Vezf1	UTSW	11	87,972,403 (GRCm39)	missense	possibly damaging	0.77
R0591:Vezf1	UTSW	11	88,068,435 (GRCm38)	critical splice donor site	probably benign
R0592:Vezf1	UTSW	11	88,068,435 (GRCm38)	critical splice donor site	probably benign
R0725:Vezf1	UTSW	11	87,964,156 (GRCm39)	missense	probably benign	0.04
R0758:Vezf1	UTSW	11	88,068,435 (GRCm38)	critical splice donor site	probably benign
R0853:Vezf1	UTSW	11	88,068,435 (GRCm38)	critical splice donor site	probably benign
R0854:Vezf1	UTSW	11	88,068,435 (GRCm38)	critical splice donor site	probably benign
R1491:Vezf1	UTSW	11	87,964,573 (GRCm39)	missense	probably damaging	1.00
R1605:Vezf1	UTSW	11	87,967,125 (GRCm39)	missense	possibly damaging	0.75
R1781:Vezf1	UTSW	11	87,972,447 (GRCm39)	missense	probably benign	0.28
R3898:Vezf1	UTSW	11	87,966,999 (GRCm39)	missense	probably benign
R4656:Vezf1	UTSW	11	87,965,493 (GRCm39)	missense	probably damaging	1.00
R4868:Vezf1	UTSW	11	87,965,520 (GRCm39)	missense	probably damaging	1.00
R5946:Vezf1	UTSW	11	87,964,560 (GRCm39)	nonsense	probably null
R6190:Vezf1	UTSW	11	87,967,012 (GRCm39)	missense	probably benign	0.02
R6258:Vezf1	UTSW	11	87,972,326 (GRCm39)	missense	probably damaging	1.00
R6260:Vezf1	UTSW	11	87,972,326 (GRCm39)	missense	probably damaging	1.00
R6452:Vezf1	UTSW	11	87,972,496 (GRCm39)	missense	possibly damaging	0.66
R6680:Vezf1	UTSW	11	87,972,410 (GRCm39)	missense	probably benign	0.23
R6983:Vezf1	UTSW	11	87,964,145 (GRCm39)	missense	possibly damaging	0.88
R7086:Vezf1	UTSW	11	87,969,364 (GRCm39)	missense	probably benign	0.00
R7322:Vezf1	UTSW	11	87,972,410 (GRCm39)	missense	possibly damaging	0.68
R7443:Vezf1	UTSW	11	87,965,489 (GRCm39)	missense	probably damaging	1.00
R8942:Vezf1	UTSW	11	87,972,553 (GRCm39)	missense	probably benign	0.11
R9006:Vezf1	UTSW	11	87,965,542 (GRCm39)	missense	probably damaging	1.00
X0019:Vezf1	UTSW	11	88,068,435 (GRCm38)	critical splice donor site	probably benign
X0067:Vezf1	UTSW	11	87,972,554 (GRCm39)	missense	probably benign	0.24
Z1176:Vezf1	UTSW	11	87,965,548 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCGGAGGTTACCGGAAGTGG -3'
(R):5'- TGGCGGCGAAGCCAGAGATACC -3'

Sequencing Primer
(F):5'- GCTGCCATGTTGAGGAgc -3'
(R):5'- AGGGTCAGAAAGTCAACACAC -3'

Posted On

2013-10-16