Incidental Mutation 'R0788:Cttnbp2'
ID76344
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
MMRRC Submission 038968-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R0788 (G1)
Quality Score198
Status Validated
Chromosome6
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18423835 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 830 (T830I)
Ref Sequence ENSEMBL: ENSMUSP00000088089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000148602]
Predicted Effect probably damaging
Transcript: ENSMUST00000090601
AA Change: T830I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416
AA Change: T830I

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137958
Predicted Effect unknown
Transcript: ENSMUST00000146775
AA Change: T320I
SMART Domains Protein: ENSMUSP00000119383
Gene: ENSMUSG00000000416
AA Change: T320I

DomainStartEndE-ValueType
low complexity region 71 79 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
ANK 190 220 5.21e1 SMART
ANK 224 253 7.02e-5 SMART
ANK 257 286 6.55e-5 SMART
ANK 290 319 4.1e-6 SMART
ANK 323 352 1.09e-1 SMART
ANK 392 422 4.43e-2 SMART
Blast:AAA 599 776 1e-18 BLAST
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148602
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152499
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,473,932 Y380* probably null Het
4931406B18Rik C A 7: 43,499,199 S196I probably damaging Het
Ablim2 T C 5: 35,857,901 S519P probably benign Het
Adnp2 A C 18: 80,130,004 C397G probably benign Het
Aldh1l2 A G 10: 83,516,164 S156P probably damaging Het
Bcl2l15 G T 3: 103,833,478 probably null Het
Brd9 T A 13: 73,944,867 probably benign Het
Cars2 A C 8: 11,529,672 I262R possibly damaging Het
Ccdc106 T C 7: 5,057,534 probably benign Het
Cdh3 G A 8: 106,541,415 V361M probably benign Het
Cdhr1 A C 14: 37,087,375 probably null Het
Cdk5rap2 A G 4: 70,307,231 I559T possibly damaging Het
Cdkn2aip T A 8: 47,713,763 Q3L possibly damaging Het
Chd1 G T 17: 15,707,114 V10F possibly damaging Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Col6a4 T C 9: 106,071,998 K813E probably benign Het
Cyp2t4 A G 7: 27,155,163 M23V probably null Het
Cyp3a16 T C 5: 145,465,076 K59E probably benign Het
Dpysl5 G A 5: 30,788,841 probably null Het
E130308A19Rik T A 4: 59,719,847 Y460N possibly damaging Het
Ear6 T A 14: 51,854,030 C11* probably null Het
Fat1 C T 8: 45,023,983 T1999M probably benign Het
Gsdmd T A 15: 75,864,254 C77* probably null Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Kif28 A T 1: 179,705,223 probably benign Het
Krt6b A G 15: 101,677,519 I373T probably damaging Het
Lgr5 T C 10: 115,452,997 T509A probably damaging Het
Mapkbp1 C T 2: 120,024,001 P1354S probably benign Het
Nat10 A G 2: 103,743,115 S346P probably damaging Het
Ncoa2 T C 1: 13,166,889 probably benign Het
Necap1 C T 6: 122,881,536 R113W probably damaging Het
Olfr365 T A 2: 37,202,023 Y261N possibly damaging Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Per1 G A 11: 69,101,359 probably benign Het
Polb T C 8: 22,642,338 D130G probably null Het
Ppcs T C 4: 119,422,178 N59S probably damaging Het
Ppp2ca A G 11: 52,113,142 E42G possibly damaging Het
Ptprf T C 4: 118,226,466 T807A probably damaging Het
Rapgef2 A C 3: 79,099,195 F284V possibly damaging Het
Sestd1 A T 2: 77,191,716 F544I probably damaging Het
Slfn3 G A 11: 83,212,836 G178S possibly damaging Het
Supt6 G A 11: 78,207,772 probably benign Het
Tas2r109 T A 6: 132,980,301 Q222L probably benign Het
Tekt4 A C 17: 25,472,047 D109A probably damaging Het
Tob2 C A 15: 81,851,702 R22L probably damaging Het
Ttn T G 2: 76,822,938 E178D possibly damaging Het
Ube2u C A 4: 100,514,740 probably benign Het
Uggt2 A G 14: 119,095,400 probably benign Het
Vstm2a T C 11: 16,259,968 F65L probably damaging Het
Zfp57 A G 17: 37,006,200 probably benign Het
Znrf3 G T 11: 5,281,320 P731Q probably benign Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
FR4304:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0165:Cttnbp2 UTSW 6 18435410 nonsense probably null
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0571:Cttnbp2 UTSW 6 18381103 missense probably benign
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1476:Cttnbp2 UTSW 6 18434221 missense probably damaging 1.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1834:Cttnbp2 UTSW 6 18501966 missense probably damaging 1.00
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R1855:Cttnbp2 UTSW 6 18378413 missense probably benign
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2204:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3414:Cttnbp2 UTSW 6 18389205 missense probably benign
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4097:Cttnbp2 UTSW 6 18420872 missense probably benign
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5484:Cttnbp2 UTSW 6 18427690 intron probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7037:Cttnbp2 UTSW 6 18435118 missense probably damaging 1.00
R7135:Cttnbp2 UTSW 6 18448447 missense possibly damaging 0.95
R7141:Cttnbp2 UTSW 6 18380468 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAGGGAGAGACTCAGAGGTCACTT -3'
(R):5'- TGGATTTAATACCTGCTCAGGGAGCC -3'

Sequencing Primer
(F):5'- cacatccctcatacaaaacacc -3'
(R):5'- AGGTGATGCCTCATCTGTATGTAAC -3'
Posted On2013-10-16