Incidental Mutation 'R0788:Chd1'
ID76372
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Namechromodomain helicase DNA binding protein 1
Synonyms4930525N21Rik
MMRRC Submission 038968-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0788 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15704967-15772610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 15707114 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 10 (V10F)
Ref Sequence ENSEMBL: ENSMUSP00000134091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024627
AA Change: V10F

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: V10F

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173159
Predicted Effect possibly damaging
Transcript: ENSMUST00000173311
AA Change: V10F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: V10F

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1078 2e-38 BLAST
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,473,932 Y380* probably null Het
4931406B18Rik C A 7: 43,499,199 S196I probably damaging Het
Ablim2 T C 5: 35,857,901 S519P probably benign Het
Adnp2 A C 18: 80,130,004 C397G probably benign Het
Aldh1l2 A G 10: 83,516,164 S156P probably damaging Het
Bcl2l15 G T 3: 103,833,478 probably null Het
Brd9 T A 13: 73,944,867 probably benign Het
Cars2 A C 8: 11,529,672 I262R possibly damaging Het
Ccdc106 T C 7: 5,057,534 probably benign Het
Cdh3 G A 8: 106,541,415 V361M probably benign Het
Cdhr1 A C 14: 37,087,375 probably null Het
Cdk5rap2 A G 4: 70,307,231 I559T possibly damaging Het
Cdkn2aip T A 8: 47,713,763 Q3L possibly damaging Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Col6a4 T C 9: 106,071,998 K813E probably benign Het
Cttnbp2 G A 6: 18,423,835 T830I probably damaging Het
Cyp2t4 A G 7: 27,155,163 M23V probably null Het
Cyp3a16 T C 5: 145,465,076 K59E probably benign Het
Dpysl5 G A 5: 30,788,841 probably null Het
E130308A19Rik T A 4: 59,719,847 Y460N possibly damaging Het
Ear6 T A 14: 51,854,030 C11* probably null Het
Fat1 C T 8: 45,023,983 T1999M probably benign Het
Gsdmd T A 15: 75,864,254 C77* probably null Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Kif28 A T 1: 179,705,223 probably benign Het
Krt6b A G 15: 101,677,519 I373T probably damaging Het
Lgr5 T C 10: 115,452,997 T509A probably damaging Het
Mapkbp1 C T 2: 120,024,001 P1354S probably benign Het
Nat10 A G 2: 103,743,115 S346P probably damaging Het
Ncoa2 T C 1: 13,166,889 probably benign Het
Necap1 C T 6: 122,881,536 R113W probably damaging Het
Olfr365 T A 2: 37,202,023 Y261N possibly damaging Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Per1 G A 11: 69,101,359 probably benign Het
Polb T C 8: 22,642,338 D130G probably null Het
Ppcs T C 4: 119,422,178 N59S probably damaging Het
Ppp2ca A G 11: 52,113,142 E42G possibly damaging Het
Ptprf T C 4: 118,226,466 T807A probably damaging Het
Rapgef2 A C 3: 79,099,195 F284V possibly damaging Het
Sestd1 A T 2: 77,191,716 F544I probably damaging Het
Slfn3 G A 11: 83,212,836 G178S possibly damaging Het
Supt6 G A 11: 78,207,772 probably benign Het
Tas2r109 T A 6: 132,980,301 Q222L probably benign Het
Tekt4 A C 17: 25,472,047 D109A probably damaging Het
Tob2 C A 15: 81,851,702 R22L probably damaging Het
Ttn T G 2: 76,822,938 E178D possibly damaging Het
Ube2u C A 4: 100,514,740 probably benign Het
Uggt2 A G 14: 119,095,400 probably benign Het
Vstm2a T C 11: 16,259,968 F65L probably damaging Het
Zfp57 A G 17: 37,006,200 probably benign Het
Znrf3 G T 11: 5,281,320 P731Q probably benign Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 intron probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15770237 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTTCCCGCAGGTGACACAGAGAG -3'
(R):5'- AGATCAAAGCCTTCTATAGTCCCTGCT -3'

Sequencing Primer
(F):5'- GTGACACAGAGAGAGCCCC -3'
(R):5'- CTTTacacacacacacacacac -3'
Posted On2013-10-16