Mutagenetix > Incidental Mutation

Incidental Mutation 'R0790:Chd8'

76448

Institutional Source

Beutler Lab

Gene Symbol

Chd8

Ensembl Gene

ENSMUSG00000053754

Gene Name

chromodomain helicase DNA binding protein 8

Synonyms

5830451P18Rik, Duplin

MMRRC Submission

038970-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0790 (G1)

Quality Score

218

Status

Validated

Chromosome

Chromosomal Location

52435608-52495237 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52441482 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 870 (D870G)

Ref Sequence

ENSEMBL: ENSMUSP00000122995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169] [ENSMUST00000227897]

AlphaFold

Q09XV5

Predicted Effect

probably benign
Transcript: ENSMUST00000089752
AA Change: D2210G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: D2210G

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136528

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145404

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147309

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147827

Predicted Effect

probably benign
Transcript: ENSMUST00000149975
AA Change: D870G

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: D870G

Domain	Start	End	E-Value	Type
low complexity region	74	93	N/A	INTRINSIC
Blast:DEXDc	112	235	9e-40	BLAST
low complexity region	239	250	N/A	INTRINSIC
low complexity region	363	374	N/A	INTRINSIC
low complexity region	430	445	N/A	INTRINSIC
Blast:SANT	456	515	1e-29	BLAST
low complexity region	547	563	N/A	INTRINSIC
low complexity region	723	767	N/A	INTRINSIC
low complexity region	882	899	N/A	INTRINSIC
BRK	972	1016	1.34e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200169
AA Change: D2210G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: D2210G

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226681

Predicted Effect

probably benign
Transcript: ENSMUST00000227897

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227448

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 92.0%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apob	A	G	12: 8,060,245 (GRCm39)	E2876G	probably damaging	Het
Arhgef28	A	G	13: 98,117,914 (GRCm39)	S585P	possibly damaging	Het
Atp11b	T	A	3: 35,887,072 (GRCm39)	N685K	probably damaging	Het
Camsap2	C	T	1: 136,201,475 (GRCm39)		probably benign	Het
Ccdc150	T	A	1: 54,316,935 (GRCm39)		probably benign	Het
Cdc23	A	G	18: 34,784,666 (GRCm39)	I32T	possibly damaging	Het
Cdca2	C	T	14: 67,917,740 (GRCm39)	D553N	probably benign	Het
Chit1	T	G	1: 134,066,490 (GRCm39)	V2G	probably benign	Het
Col4a4	G	A	1: 82,502,717 (GRCm39)	P356S	unknown	Het
Cpsf4l	A	G	11: 113,597,234 (GRCm39)		probably benign	Het
Etaa1	G	T	11: 17,896,051 (GRCm39)	Q689K	probably benign	Het
Fam83h	C	T	15: 75,875,241 (GRCm39)	V699I	probably benign	Het
Fry	A	G	5: 150,389,902 (GRCm39)	D2545G	probably benign	Het
Hsp90ab1	ACTTCTT	ACTT	17: 45,880,425 (GRCm39)		probably benign	Het
Kif5a	T	C	10: 127,081,878 (GRCm39)		probably benign	Het
Lifr	A	G	15: 7,215,196 (GRCm39)	T768A	probably benign	Het
Mrap2	T	C	9: 87,064,835 (GRCm39)	L192P	possibly damaging	Het
Myo18a	G	A	11: 77,731,535 (GRCm39)	R840Q	possibly damaging	Het
Myrfl	T	C	10: 116,653,693 (GRCm39)	D458G	probably damaging	Het
Or12j4	T	C	7: 140,046,962 (GRCm39)	S283P	possibly damaging	Het
Or51s1	A	G	7: 102,558,843 (GRCm39)	Y68H	probably benign	Het
Pcdh15	A	G	10: 74,466,885 (GRCm39)	E1034G	probably benign	Het
Pirb	A	T	7: 3,720,637 (GRCm39)	L287Q	probably benign	Het
Plcb2	G	A	2: 118,542,964 (GRCm39)		probably benign	Het
Psmd1	T	C	1: 86,005,172 (GRCm39)	V202A	possibly damaging	Het
Raet1d	T	C	10: 22,246,795 (GRCm39)	I41T	probably damaging	Het
Retnlb	T	A	16: 48,637,589 (GRCm39)	L5Q	possibly damaging	Het
Sh3rf1	T	C	8: 61,782,292 (GRCm39)	Y145H	probably damaging	Het
Smad7	C	T	18: 75,526,933 (GRCm39)	H260Y	probably benign	Het
Stk10	T	C	11: 32,548,653 (GRCm39)	V407A	probably benign	Het
Synpo	A	G	18: 60,736,575 (GRCm39)	V218A	probably damaging	Het
Tll2	T	A	19: 41,092,289 (GRCm39)	Y499F	probably damaging	Het
Vrk1	C	T	12: 106,036,883 (GRCm39)	P390S	probably benign	Het
Zfp748	A	C	13: 67,693,481 (GRCm39)	L64W	probably benign	Het

Other mutations in Chd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Chd8	APN	14	52,463,595 (GRCm39)	missense	probably damaging	0.99
IGL00694:Chd8	APN	14	52,455,427 (GRCm39)	missense	probably damaging	1.00
IGL01011:Chd8	APN	14	52,468,989 (GRCm39)	missense	possibly damaging	0.86
IGL01022:Chd8	APN	14	52,474,450 (GRCm39)	missense	probably benign
IGL01066:Chd8	APN	14	52,455,223 (GRCm39)	missense	probably damaging	1.00
IGL01083:Chd8	APN	14	52,458,877 (GRCm39)	missense	probably damaging	1.00
IGL01313:Chd8	APN	14	52,448,032 (GRCm39)	missense	probably damaging	1.00
IGL01396:Chd8	APN	14	52,442,044 (GRCm39)	unclassified	probably benign
IGL01476:Chd8	APN	14	52,442,947 (GRCm39)	missense	probably benign	0.32
IGL01731:Chd8	APN	14	52,450,111 (GRCm39)	missense	probably benign	0.12
IGL01895:Chd8	APN	14	52,436,551 (GRCm39)	missense	probably benign	0.00
IGL02090:Chd8	APN	14	52,464,691 (GRCm39)	critical splice donor site	probably null
IGL02344:Chd8	APN	14	52,439,107 (GRCm39)	missense	probably damaging	1.00
IGL02573:Chd8	APN	14	52,457,191 (GRCm39)	missense	possibly damaging	0.95
IGL02601:Chd8	APN	14	52,451,757 (GRCm39)	missense	possibly damaging	0.94
IGL02617:Chd8	APN	14	52,472,648 (GRCm39)	missense	probably benign	0.34
IGL02873:Chd8	APN	14	52,459,970 (GRCm39)	missense	probably damaging	0.99
IGL02974:Chd8	APN	14	52,439,158 (GRCm39)	splice site	probably null
IGL03058:Chd8	APN	14	52,455,730 (GRCm39)	missense	probably damaging	1.00
IGL03076:Chd8	APN	14	52,463,619 (GRCm39)	splice site	probably benign
IGL03239:Chd8	APN	14	52,465,005 (GRCm39)	missense	possibly damaging	0.92
PIT4431001:Chd8	UTSW	14	52,455,706 (GRCm39)	missense	probably damaging	0.98
PIT4468001:Chd8	UTSW	14	52,455,338 (GRCm39)	missense	possibly damaging	0.95
PIT4468001:Chd8	UTSW	14	52,445,453 (GRCm39)	missense	probably benign
R0006:Chd8	UTSW	14	52,472,750 (GRCm39)	missense	possibly damaging	0.51
R0006:Chd8	UTSW	14	52,472,750 (GRCm39)	missense	possibly damaging	0.51
R0022:Chd8	UTSW	14	52,470,312 (GRCm39)	missense	probably benign	0.00
R0115:Chd8	UTSW	14	52,474,663 (GRCm39)	missense	probably benign	0.00
R0131:Chd8	UTSW	14	52,442,783 (GRCm39)	missense	probably benign	0.15
R0131:Chd8	UTSW	14	52,442,783 (GRCm39)	missense	probably benign	0.15
R0132:Chd8	UTSW	14	52,442,783 (GRCm39)	missense	probably benign	0.15
R0419:Chd8	UTSW	14	52,441,517 (GRCm39)	missense	probably benign	0.24
R0440:Chd8	UTSW	14	52,442,283 (GRCm39)	missense	possibly damaging	0.91
R0452:Chd8	UTSW	14	52,452,044 (GRCm39)	missense	probably damaging	1.00
R0481:Chd8	UTSW	14	52,474,663 (GRCm39)	missense	probably benign	0.00
R0624:Chd8	UTSW	14	52,457,214 (GRCm39)	missense	possibly damaging	0.65
R0650:Chd8	UTSW	14	52,439,761 (GRCm39)	missense	probably benign	0.09
R0691:Chd8	UTSW	14	52,450,890 (GRCm39)	missense	probably damaging	0.96
R0835:Chd8	UTSW	14	52,441,482 (GRCm39)	missense	probably benign	0.07
R1180:Chd8	UTSW	14	52,458,565 (GRCm39)	missense	probably damaging	1.00
R1411:Chd8	UTSW	14	52,462,103 (GRCm39)	missense	probably benign
R1725:Chd8	UTSW	14	52,470,030 (GRCm39)	missense	probably benign	0.08
R1838:Chd8	UTSW	14	52,442,340 (GRCm39)	missense	probably benign	0.11
R1839:Chd8	UTSW	14	52,442,340 (GRCm39)	missense	probably benign	0.11
R1968:Chd8	UTSW	14	52,458,450 (GRCm39)	missense	probably damaging	0.98
R2020:Chd8	UTSW	14	52,452,698 (GRCm39)	missense	probably damaging	1.00
R2024:Chd8	UTSW	14	52,468,950 (GRCm39)	missense	probably benign	0.23
R2139:Chd8	UTSW	14	52,474,428 (GRCm39)	missense	probably benign	0.32
R2163:Chd8	UTSW	14	52,436,275 (GRCm39)	missense	possibly damaging	0.53
R2342:Chd8	UTSW	14	52,442,674 (GRCm39)	missense	probably benign	0.25
R2844:Chd8	UTSW	14	52,441,952 (GRCm39)	missense	possibly damaging	0.92
R3500:Chd8	UTSW	14	52,443,110 (GRCm39)	missense	probably benign	0.00
R3861:Chd8	UTSW	14	52,474,578 (GRCm39)	missense	probably benign	0.13
R4154:Chd8	UTSW	14	52,444,668 (GRCm39)	unclassified	probably benign
R4445:Chd8	UTSW	14	52,441,984 (GRCm39)	splice site	probably null
R4628:Chd8	UTSW	14	52,444,372 (GRCm39)	missense	probably benign	0.03
R4779:Chd8	UTSW	14	52,468,963 (GRCm39)	missense	probably damaging	1.00
R4783:Chd8	UTSW	14	52,442,825 (GRCm39)	missense	probably damaging	1.00
R4784:Chd8	UTSW	14	52,442,825 (GRCm39)	missense	probably damaging	1.00
R5001:Chd8	UTSW	14	52,441,372 (GRCm39)	missense	probably benign	0.09
R5280:Chd8	UTSW	14	52,442,582 (GRCm39)	missense	possibly damaging	0.68
R5331:Chd8	UTSW	14	52,439,571 (GRCm39)	intron	probably benign
R5348:Chd8	UTSW	14	52,470,155 (GRCm39)	missense	probably damaging	1.00
R5375:Chd8	UTSW	14	52,441,611 (GRCm39)	missense	probably damaging	1.00
R5470:Chd8	UTSW	14	52,450,066 (GRCm39)	missense	probably damaging	1.00
R5479:Chd8	UTSW	14	52,452,652 (GRCm39)	missense	probably benign	0.15
R5488:Chd8	UTSW	14	52,450,505 (GRCm39)	intron	probably benign
R5489:Chd8	UTSW	14	52,450,505 (GRCm39)	intron	probably benign
R5499:Chd8	UTSW	14	52,441,888 (GRCm39)	critical splice donor site	probably null
R5988:Chd8	UTSW	14	52,455,395 (GRCm39)	missense	probably damaging	1.00
R6046:Chd8	UTSW	14	52,458,528 (GRCm39)	missense	possibly damaging	0.60
R6125:Chd8	UTSW	14	52,444,491 (GRCm39)	missense	probably benign	0.16
R6212:Chd8	UTSW	14	52,439,155 (GRCm39)	missense	probably damaging	1.00
R6337:Chd8	UTSW	14	52,441,566 (GRCm39)	missense	probably damaging	1.00
R6394:Chd8	UTSW	14	52,440,042 (GRCm39)	missense	possibly damaging	0.66
R6576:Chd8	UTSW	14	52,453,533 (GRCm39)	missense	probably damaging	1.00
R6590:Chd8	UTSW	14	52,464,694 (GRCm39)	missense	possibly damaging	0.60
R6690:Chd8	UTSW	14	52,464,694 (GRCm39)	missense	possibly damaging	0.60
R6786:Chd8	UTSW	14	52,464,125 (GRCm39)	missense	probably benign	0.33
R6913:Chd8	UTSW	14	52,451,951 (GRCm39)	missense	probably damaging	0.99
R7090:Chd8	UTSW	14	52,452,677 (GRCm39)	missense	probably damaging	0.99
R7107:Chd8	UTSW	14	52,450,129 (GRCm39)	missense	probably benign	0.07
R7138:Chd8	UTSW	14	52,451,955 (GRCm39)	missense	possibly damaging	0.83
R7383:Chd8	UTSW	14	52,452,776 (GRCm39)	missense	probably damaging	1.00
R7392:Chd8	UTSW	14	52,470,312 (GRCm39)	missense	probably benign
R7471:Chd8	UTSW	14	52,441,569 (GRCm39)	missense	probably benign
R7625:Chd8	UTSW	14	52,474,534 (GRCm39)	missense	probably benign	0.04
R7790:Chd8	UTSW	14	52,463,539 (GRCm39)	missense	probably damaging	1.00
R7862:Chd8	UTSW	14	52,451,734 (GRCm39)	missense	probably damaging	1.00
R7937:Chd8	UTSW	14	52,464,963 (GRCm39)	missense	probably benign	0.02
R8092:Chd8	UTSW	14	52,455,184 (GRCm39)	missense	probably damaging	1.00
R8237:Chd8	UTSW	14	52,450,809 (GRCm39)	missense	probably damaging	1.00
R8321:Chd8	UTSW	14	52,470,024 (GRCm39)	missense	probably benign	0.01
R8371:Chd8	UTSW	14	52,470,275 (GRCm39)	missense	probably benign
R8425:Chd8	UTSW	14	52,448,012 (GRCm39)	missense	probably damaging	1.00
R8674:Chd8	UTSW	14	52,450,463 (GRCm39)	missense	probably damaging	0.98
R8794:Chd8	UTSW	14	52,441,904 (GRCm39)	missense	probably damaging	0.98
R8828:Chd8	UTSW	14	52,448,037 (GRCm39)	frame shift	probably null
R8909:Chd8	UTSW	14	52,450,389 (GRCm39)	missense	possibly damaging	0.82
R9194:Chd8	UTSW	14	52,439,650 (GRCm39)	missense	probably benign	0.01
R9278:Chd8	UTSW	14	52,472,627 (GRCm39)	missense	probably benign	0.01
R9489:Chd8	UTSW	14	52,457,055 (GRCm39)	missense	probably damaging	0.98
R9501:Chd8	UTSW	14	52,452,045 (GRCm39)	missense	probably benign	0.04
R9546:Chd8	UTSW	14	52,453,408 (GRCm39)	missense	probably damaging	1.00
R9605:Chd8	UTSW	14	52,457,055 (GRCm39)	missense	probably damaging	0.98
R9694:Chd8	UTSW	14	52,441,341 (GRCm39)	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- TGTGTTTAGTGATCCACATGCCTCG -3'
(R):5'- CGTGTTCTGATAAACCGCATTGACC -3'

Sequencing Primer
(F):5'- cacatgcctcggccttc -3'
(R):5'- GATAAACCGCATTGACCTCGTC -3'

Posted On

2013-10-16