Mutagenetix > Incidental Mutation

Incidental Mutation 'R0793:P3h3'

76459

Institutional Source

Beutler Lab

Gene Symbol

P3h3

Ensembl Gene

ENSMUSG00000023191

Gene Name

prolyl 3-hydroxylase 3

Synonyms

Leprel2, Grcb

MMRRC Submission

038973-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0793 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124818052-124834680 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 124831896 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 296 (D296E)

Ref Sequence

ENSEMBL: ENSMUSP00000116338 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000046893] [ENSMUST00000135127] [ENSMUST00000204667]

AlphaFold

Q8CG70

Predicted Effect

probably benign
Transcript: ENSMUST00000023958
AA Change: D296E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191
AA Change: D296E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	58	76	N/A	INTRINSIC
low complexity region	127	142	N/A	INTRINSIC
low complexity region	222	242	N/A	INTRINSIC
low complexity region	256	277	N/A	INTRINSIC
P4Hc	460	670	8.51e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000046893

SMART Domains

Protein: ENSMUSP00000038536
Gene: ENSMUSG00000038390

Domain	Start	End	E-Value	Type
Pfam:7tm_1	30	337	1.1e-19	PFAM
low complexity region	348	362	N/A	INTRINSIC
low complexity region	462	477	N/A	INTRINSIC
low complexity region	482	504	N/A	INTRINSIC
low complexity region	513	540	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129225

Predicted Effect

probably benign
Transcript: ENSMUST00000135127
AA Change: D296E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191
AA Change: D296E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	58	76	N/A	INTRINSIC
low complexity region	127	142	N/A	INTRINSIC
low complexity region	222	242	N/A	INTRINSIC
low complexity region	256	277	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135546

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147296

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149870

Predicted Effect

probably benign
Transcript: ENSMUST00000204667

SMART Domains

Protein: ENSMUSP00000145267
Gene: ENSMUSG00000038390

Domain	Start	End	E-Value	Type
Pfam:7tm_1	30	337	1.1e-19	PFAM
low complexity region	348	362	N/A	INTRINSIC
low complexity region	462	477	N/A	INTRINSIC
low complexity region	482	504	N/A	INTRINSIC
low complexity region	513	540	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204161

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.7%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leprecan family of proteoglycans, which function as collagen prolyl hydroxylases that are required for proper collagen biosynthesis, folding and assembly. This protein, like other family members, is thought to reside in the endoplasmic reticulum. Epigenetic inactivation of this gene is associated with breast and other cancers, suggesting that it may function as a tumor suppressor. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit collagen fiber fragility in the skin. [provided by MGI curators]

Allele List at MGI

Other mutations in P3h3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:P3h3	APN	6	124,822,552 (GRCm39)	missense	probably benign	0.26
IGL02158:P3h3	APN	6	124,830,055 (GRCm39)	missense	probably damaging	1.00
IGL02654:P3h3	APN	6	124,822,228 (GRCm39)	missense	possibly damaging	0.95
P0040:P3h3	UTSW	6	124,830,099 (GRCm39)	missense	probably damaging	0.99
R0024:P3h3	UTSW	6	124,834,421 (GRCm39)	missense	probably benign
R0196:P3h3	UTSW	6	124,822,235 (GRCm39)	missense	probably damaging	1.00
R0328:P3h3	UTSW	6	124,831,269 (GRCm39)	unclassified	probably benign
R0589:P3h3	UTSW	6	124,818,644 (GRCm39)	missense	probably damaging	1.00
R0605:P3h3	UTSW	6	124,832,998 (GRCm39)	missense	probably damaging	1.00
R0794:P3h3	UTSW	6	124,831,896 (GRCm39)	missense	probably benign	0.00
R0795:P3h3	UTSW	6	124,831,896 (GRCm39)	missense	probably benign	0.00
R0796:P3h3	UTSW	6	124,831,896 (GRCm39)	missense	probably benign	0.00
R0853:P3h3	UTSW	6	124,831,896 (GRCm39)	missense	probably benign	0.00
R0854:P3h3	UTSW	6	124,831,896 (GRCm39)	missense	probably benign	0.00
R0856:P3h3	UTSW	6	124,831,896 (GRCm39)	missense	probably benign	0.00
R0893:P3h3	UTSW	6	124,822,476 (GRCm39)	missense	probably damaging	1.00
R1819:P3h3	UTSW	6	124,831,895 (GRCm39)	missense	probably benign	0.05
R2100:P3h3	UTSW	6	124,822,005 (GRCm39)	missense	probably damaging	1.00
R4332:P3h3	UTSW	6	124,819,099 (GRCm39)	missense	probably damaging	1.00
R4461:P3h3	UTSW	6	124,822,531 (GRCm39)	missense	probably benign	0.08
R4533:P3h3	UTSW	6	124,831,371 (GRCm39)	missense	possibly damaging	0.62
R4829:P3h3	UTSW	6	124,818,601 (GRCm39)	utr 3 prime	probably benign
R4840:P3h3	UTSW	6	124,827,600 (GRCm39)	missense	possibly damaging	0.82
R4962:P3h3	UTSW	6	124,818,736 (GRCm39)	missense	probably benign	0.09
R5014:P3h3	UTSW	6	124,832,199 (GRCm39)	missense	probably damaging	1.00
R5591:P3h3	UTSW	6	124,831,658 (GRCm39)	unclassified	probably benign
R5691:P3h3	UTSW	6	124,832,116 (GRCm39)	missense	probably damaging	1.00
R5777:P3h3	UTSW	6	124,832,921 (GRCm39)	missense	probably benign	0.24
R5846:P3h3	UTSW	6	124,834,157 (GRCm39)	critical splice donor site	probably null
R6212:P3h3	UTSW	6	124,822,606 (GRCm39)	missense	probably benign	0.19
R6254:P3h3	UTSW	6	124,822,564 (GRCm39)	missense	probably damaging	1.00
R6320:P3h3	UTSW	6	124,831,835 (GRCm39)	missense	probably benign	0.02
R6860:P3h3	UTSW	6	124,834,331 (GRCm39)	missense	probably benign	0.01
R7385:P3h3	UTSW	6	124,832,233 (GRCm39)	missense	probably damaging	1.00
R7472:P3h3	UTSW	6	124,827,594 (GRCm39)	missense	possibly damaging	0.92
R7617:P3h3	UTSW	6	124,832,969 (GRCm39)	missense	probably damaging	1.00
R7763:P3h3	UTSW	6	124,831,395 (GRCm39)	missense	probably benign	0.00
R7831:P3h3	UTSW	6	124,832,118 (GRCm39)	missense	possibly damaging	0.86
R8317:P3h3	UTSW	6	124,832,116 (GRCm39)	missense	probably damaging	1.00
R8436:P3h3	UTSW	6	124,828,041 (GRCm39)	critical splice donor site	probably null
R8749:P3h3	UTSW	6	124,822,940 (GRCm39)	missense	probably damaging	0.99
R8944:P3h3	UTSW	6	124,832,196 (GRCm39)	missense	possibly damaging	0.86
R8988:P3h3	UTSW	6	124,834,564 (GRCm39)	missense	possibly damaging	0.74
R9508:P3h3	UTSW	6	124,830,012 (GRCm39)	critical splice donor site	probably null
X0021:P3h3	UTSW	6	124,832,992 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAAGGACACCATCCTGAAGCTGAG -3'
(R):5'- CCTGTATGAAGCCATTGCAGGTGAG -3'

Sequencing Primer
(F):5'- CCTGACAGTGAAATTAGCAATGC -3'
(R):5'- CCATTGCAGGTGAGGGAGG -3'

Posted On

2013-10-16