Incidental Mutation 'R0798:4930579C12Rik'
List |< first << previous [record 94 of 1920] next >> last >|
ID76492
Institutional Source Beutler Lab
Gene Symbol 4930579C12Rik
Ensembl Gene ENSMUSG00000074146
Gene NameRIKEN cDNA 4930579C12 gene
Synonyms
MMRRC Submission 038978-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R0798 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location89113111-89177887 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 89152827 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098484
SMART Domains Protein: ENSMUSP00000096085
Gene: ENSMUSG00000074146

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187015
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Baz2a T A 10: 128,126,323 probably benign Het
Bcar3 T C 3: 122,525,299 V695A probably benign Het
C130074G19Rik G A 1: 184,882,676 probably benign Het
Cmas T C 6: 142,764,656 V167A probably damaging Het
Cyp3a25 T C 5: 145,991,533 E234G probably damaging Het
Fam208a T A 14: 27,476,636 F1308L probably damaging Het
Gopc C T 10: 52,358,811 G79S probably damaging Het
Herc2 T A 7: 56,135,683 probably null Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ispd G A 12: 36,521,999 R302H probably benign Het
Kcnq5 A G 1: 21,961,175 probably null Het
Lpp G T 16: 24,971,872 G29* probably null Het
Ly6g6e T C 17: 35,078,041 F86S probably benign Het
Myo5c T C 9: 75,257,984 F358S probably damaging Het
Nlgn1 A G 3: 25,434,246 Y613H probably benign Het
Olfr1282 T C 2: 111,335,344 I245V probably benign Het
Olfr18 A T 9: 20,314,199 Y232* probably null Het
Plekhn1 T A 4: 156,228,263 D46V probably damaging Het
Ptp4a1 A T 1: 30,944,924 probably benign Het
Rab23 A T 1: 33,734,827 I123F probably damaging Het
Samd4b G A 7: 28,401,623 probably benign Het
Shisa4 G A 1: 135,373,148 probably benign Het
Slc39a11 C T 11: 113,523,504 A90T probably benign Het
Tas1r2 T C 4: 139,669,713 Y788H probably damaging Het
Tial1 C T 7: 128,443,878 M327I probably benign Het
Ubr2 C T 17: 46,969,176 probably benign Het
Utp4 T C 8: 106,922,226 S630P probably benign Het
Vmn1r212 T C 13: 22,883,698 N155S probably damaging Het
Zmym6 C T 4: 127,103,523 P312S probably benign Het
Other mutations in 4930579C12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0837:4930579C12Rik UTSW 9 89168207 splice site noncoding transcript
R1804:4930579C12Rik UTSW 9 89152060 splice site noncoding transcript
R1861:4930579C12Rik UTSW 9 89152831 exon noncoding transcript
R1889:4930579C12Rik UTSW 9 89152762 splice site noncoding transcript
R4044:4930579C12Rik UTSW 9 89162294 exon noncoding transcript
R5294:4930579C12Rik UTSW 9 89152003 exon noncoding transcript
R5454:4930579C12Rik UTSW 9 89168988 critical splice acceptor site noncoding transcript
R5756:4930579C12Rik UTSW 9 89128866 critical splice donor site noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGGAAACTTCCCTCACAGTGGTCTC -3'
(R):5'- GTTCTGAAATGAGCAGCAAGCAACC -3'

Sequencing Primer
(F):5'- TCACAGTGGTCTCTGAGGAAC -3'
(R):5'- GCAACCTCTGCTTAATAATTAGACTG -3'
Posted On2013-10-16