Incidental Mutation 'R0799:Chd7'
ID76515
Institutional Source Beutler Lab
Gene Symbol Chd7
Ensembl Gene ENSMUSG00000041235
Gene Namechromodomain helicase DNA binding protein 7
SynonymsA730019I05Rik, Cycn, Cyn, Dz, Edy, Flo, GENA 47, Gena 52, GENA 60, Lda, Mt, Obt, Todo, WBE1, Whi
MMRRC Submission 038979-MU
Accession Numbers

Genbank: NM_001081417; MGI: 2444748

Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location8690406-8867659 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 8801310 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000170391]
Predicted Effect probably benign
Transcript: ENSMUST00000039267
SMART Domains Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051558
SMART Domains Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170391
SMART Domains Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
BRK 586 630 3.77e-23 SMART
low complexity region 670 680 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 724 733 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 765 776 N/A INTRINSIC
low complexity region 852 871 N/A INTRINSIC
low complexity region 922 935 N/A INTRINSIC
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Chd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Chd7 APN 4 8859106 missense probably damaging 1.00
IGL00510:Chd7 APN 4 8801404 missense probably damaging 1.00
IGL00741:Chd7 APN 4 8839454 missense probably damaging 1.00
IGL00796:Chd7 APN 4 8847271 missense possibly damaging 0.95
IGL00907:Chd7 APN 4 8840435 missense probably damaging 0.98
IGL00930:Chd7 APN 4 8805181 missense probably damaging 1.00
IGL01542:Chd7 APN 4 8859285 missense possibly damaging 0.71
IGL01602:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01605:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01670:Chd7 APN 4 8827033 missense probably damaging 0.98
IGL02434:Chd7 APN 4 8752145 missense probably benign 0.00
IGL02531:Chd7 APN 4 8854134 missense probably damaging 1.00
IGL02626:Chd7 APN 4 8826519 missense probably damaging 1.00
IGL02961:Chd7 APN 4 8751542 missense probably damaging 1.00
IGL02972:Chd7 APN 4 8855174 missense probably benign 0.30
IGL03329:Chd7 APN 4 8841108 missense probably damaging 1.00
Fili UTSW 4 8839523 missense probably damaging 1.00
D4043:Chd7 UTSW 4 8862650 missense probably damaging 1.00
IGL02991:Chd7 UTSW 4 8828398 missense possibly damaging 0.91
PIT4466001:Chd7 UTSW 4 8753101 missense unknown
PIT4472001:Chd7 UTSW 4 8753101 missense unknown
R0157:Chd7 UTSW 4 8833759 missense probably damaging 1.00
R0179:Chd7 UTSW 4 8862516 missense probably benign 0.22
R0240:Chd7 UTSW 4 8852670 unclassified probably benign
R0388:Chd7 UTSW 4 8854560 missense probably benign 0.27
R0462:Chd7 UTSW 4 8850821 missense probably damaging 1.00
R0512:Chd7 UTSW 4 8805139 intron probably benign
R0657:Chd7 UTSW 4 8753141 missense probably damaging 1.00
R0885:Chd7 UTSW 4 8866432 missense probably damaging 1.00
R1056:Chd7 UTSW 4 8822402 missense possibly damaging 0.50
R1086:Chd7 UTSW 4 8866458 missense probably benign 0.04
R1353:Chd7 UTSW 4 8839556 missense probably damaging 0.99
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1605:Chd7 UTSW 4 8844675 missense probably damaging 1.00
R1693:Chd7 UTSW 4 8864307 critical splice donor site probably null
R1695:Chd7 UTSW 4 8833960 missense probably damaging 1.00
R1938:Chd7 UTSW 4 8847200 missense probably damaging 1.00
R1964:Chd7 UTSW 4 8865978 missense probably damaging 0.96
R2020:Chd7 UTSW 4 8855226 missense probably benign 0.00
R2134:Chd7 UTSW 4 8753147 missense probably damaging 0.99
R2171:Chd7 UTSW 4 8752424 missense probably damaging 1.00
R2271:Chd7 UTSW 4 8785532 missense probably damaging 1.00
R2300:Chd7 UTSW 4 8855241 missense probably benign 0.02
R2355:Chd7 UTSW 4 8801350 missense possibly damaging 0.95
R3153:Chd7 UTSW 4 8855174 missense probably benign 0.30
R3430:Chd7 UTSW 4 8844517 missense probably damaging 0.99
R3746:Chd7 UTSW 4 8752537 missense probably damaging 1.00
R4118:Chd7 UTSW 4 8865831 missense probably damaging 1.00
R4119:Chd7 UTSW 4 8785658 intron probably benign
R4332:Chd7 UTSW 4 8854143 missense probably damaging 1.00
R4402:Chd7 UTSW 4 8866353 missense possibly damaging 0.61
R4571:Chd7 UTSW 4 8866217 missense probably benign 0.09
R4722:Chd7 UTSW 4 8822445 missense probably damaging 1.00
R4821:Chd7 UTSW 4 8844706 missense probably damaging 1.00
R4894:Chd7 UTSW 4 8838629 missense probably damaging 0.99
R5205:Chd7 UTSW 4 8752509 missense possibly damaging 0.60
R5344:Chd7 UTSW 4 8844417 missense probably damaging 1.00
R5484:Chd7 UTSW 4 8828258 missense probably damaging 1.00
R5578:Chd7 UTSW 4 8847149 missense probably benign 0.09
R5583:Chd7 UTSW 4 8752473 missense probably damaging 1.00
R5888:Chd7 UTSW 4 8866382 missense probably damaging 0.98
R5905:Chd7 UTSW 4 8840553 missense possibly damaging 0.91
R6091:Chd7 UTSW 4 8751875 missense probably damaging 0.99
R6126:Chd7 UTSW 4 8826482 missense probably damaging 1.00
R6399:Chd7 UTSW 4 8828274 missense probably damaging 1.00
R6751:Chd7 UTSW 4 8833866 missense probably damaging 1.00
R6810:Chd7 UTSW 4 8839523 missense probably damaging 1.00
R6868:Chd7 UTSW 4 8811501 splice site probably null
R6952:Chd7 UTSW 4 8856797 missense probably damaging 1.00
R6986:Chd7 UTSW 4 8859285 missense possibly damaging 0.71
R6990:Chd7 UTSW 4 8844525 missense probably benign 0.28
R7139:Chd7 UTSW 4 8865865 missense probably benign 0.00
R7288:Chd7 UTSW 4 8847093 missense possibly damaging 0.92
R7355:Chd7 UTSW 4 8752196 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCACAGCTTTGTATGTCAGCAGG -3'
(R):5'- GCCCCGAAGGGAATAATGGTGTTAC -3'

Sequencing Primer
(F):5'- GTGAGAAATTTGCTGAAGGTCATC -3'
(R):5'- ATAATGGTGTTACCTGGACACCTG -3'
Posted On2013-10-16