Incidental Mutation 'R0781:Ttc30a1'
ID76606
Institutional Source Beutler Lab
Gene Symbol Ttc30a1
Ensembl Gene ENSMUSG00000075271
Gene Nametetratricopeptide repeat domain 30A1
Synonyms
MMRRC Submission 038961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R0781 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location75978247-75981967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75979976 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 588 (C588S)
Ref Sequence ENSEMBL: ENSMUSP00000097574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099994] [ENSMUST00000099995]
Predicted Effect probably damaging
Transcript: ENSMUST00000099994
AA Change: C588S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097574
Gene: ENSMUSG00000075271
AA Change: C588S

DomainStartEndE-ValueType
TPR 45 78 1.1e-1 SMART
TPR 153 186 2.19e1 SMART
TPR 187 220 6.24e1 SMART
coiled coil region 380 411 N/A INTRINSIC
TPR 423 456 2.24e1 SMART
Blast:TPR 457 491 1e-10 BLAST
low complexity region 514 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099995
SMART Domains Protein: ENSMUSP00000097575
Gene: ENSMUSG00000075272

DomainStartEndE-ValueType
TPR 45 78 1.1e-1 SMART
TPR 153 186 2.77e1 SMART
Blast:TPR 187 224 1e-13 BLAST
coiled coil region 380 405 N/A INTRINSIC
TPR 423 456 2.24e1 SMART
Blast:TPR 457 491 1e-10 BLAST
low complexity region 514 528 N/A INTRINSIC
Meta Mutation Damage Score 0.38 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.2%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik G T 17: 79,627,751 A98S probably benign Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Ankrd55 A G 13: 112,381,233 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Csmd1 A C 8: 15,921,174 I3047S probably benign Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gdf7 C A 12: 8,301,555 probably benign Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Iqcf4 T C 9: 106,568,661 I96V probably benign Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Itpr3 C T 17: 27,110,555 H1518Y probably benign Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kntc1 C T 5: 123,799,902 probably benign Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nudt7 G A 8: 114,135,371 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr194 A T 16: 59,119,824 V82D probably damaging Het
Olfr78 A G 7: 102,743,007 probably benign Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Opa3 A G 7: 19,228,599 probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkhd1 A T 1: 20,117,484 N3533K probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Ppef2 T C 5: 92,244,830 K261R probably benign Het
Prdm14 A G 1: 13,114,361 S529P probably damaging Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Slc26a3 A T 12: 31,465,813 I571F possibly damaging Het
Slc5a5 A T 8: 70,890,220 M232K probably benign Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Ss18l1 G A 2: 180,055,854 S177N possibly damaging Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Tmem108 C T 9: 103,484,690 V566M probably damaging Het
Trmu C A 15: 85,879,403 C9* probably null Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Vps13c T A 9: 67,972,003 Y3409N probably damaging Het
Xrn1 T A 9: 95,991,269 N695K probably benign Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Ttc30a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Ttc30a1 APN 2 75981741 unclassified probably benign
IGL01140:Ttc30a1 APN 2 75979915 missense probably benign 0.01
IGL01527:Ttc30a1 APN 2 75980516 missense probably benign
IGL01690:Ttc30a1 APN 2 75979933 missense probably benign
IGL01916:Ttc30a1 APN 2 75980879 missense probably damaging 0.98
IGL02342:Ttc30a1 APN 2 75980632 missense probably benign 0.45
IGL02728:Ttc30a1 APN 2 75980849 missense probably benign 0.01
IGL03171:Ttc30a1 APN 2 75980507 missense probably benign 0.00
PIT4677001:Ttc30a1 UTSW 2 75979769 missense possibly damaging 0.60
R1110:Ttc30a1 UTSW 2 75979976 missense probably damaging 0.98
R1185:Ttc30a1 UTSW 2 75980352 missense probably damaging 1.00
R1185:Ttc30a1 UTSW 2 75980352 missense probably damaging 1.00
R1750:Ttc30a1 UTSW 2 75980255 missense probably benign 0.21
R2016:Ttc30a1 UTSW 2 75981457 missense probably benign 0.42
R2017:Ttc30a1 UTSW 2 75981457 missense probably benign 0.42
R2020:Ttc30a1 UTSW 2 75980935 missense probably benign
R3606:Ttc30a1 UTSW 2 75981277 missense probably benign 0.06
R4272:Ttc30a1 UTSW 2 75980474 missense probably damaging 1.00
R4600:Ttc30a1 UTSW 2 75980633 missense probably benign 0.26
R4894:Ttc30a1 UTSW 2 75979744 makesense probably null
R4996:Ttc30a1 UTSW 2 75979922 missense probably benign
R5217:Ttc30a1 UTSW 2 75980803 missense probably damaging 1.00
R5721:Ttc30a1 UTSW 2 75981371 missense probably damaging 0.99
R6002:Ttc30a1 UTSW 2 75980777 missense possibly damaging 0.59
R6006:Ttc30a1 UTSW 2 75981488 missense probably benign 0.08
R7316:Ttc30a1 UTSW 2 75980857 missense probably damaging 1.00
R7391:Ttc30a1 UTSW 2 75980015 missense probably benign 0.05
R7494:Ttc30a1 UTSW 2 75979898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAATGTCATGTAGCTAAGGCCC -3'
(R):5'- AGGAACAACTCTCTTATGGTGACCCAG -3'

Sequencing Primer
(F):5'- GCTTAGAGTTGAAACACAATGCC -3'
(R):5'- TCTCTTATGGTGACCCAGACAAG -3'
Posted On2013-10-16