Incidental Mutation 'R0782:Ilkap'
ID76666
Institutional Source Beutler Lab
Gene Symbol Ilkap
Ensembl Gene ENSMUSG00000026309
Gene Nameintegrin-linked kinase-associated serine/threonine phosphatase 2C
Synonyms1600009O09Rik, 0710007A14Rik, PP2C-DELTA
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R0782 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location91373861-91398815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91378550 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 103 (R103H)
Ref Sequence ENSEMBL: ENSMUSP00000140905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027534] [ENSMUST00000086861] [ENSMUST00000187306] [ENSMUST00000187678] [ENSMUST00000190747]
Predicted Effect probably damaging
Transcript: ENSMUST00000027534
AA Change: R291H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027534
Gene: ENSMUSG00000026309
AA Change: R291H

DomainStartEndE-ValueType
Blast:PP2C_SIG 26 64 4e-12 BLAST
PP2Cc 94 388 4.47e-93 SMART
PP2C_SIG 128 390 9.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086861
SMART Domains Protein: ENSMUSP00000084073
Gene: ENSMUSG00000047443

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 40 58 N/A INTRINSIC
low complexity region 85 113 N/A INTRINSIC
low complexity region 170 180 N/A INTRINSIC
Blast:TNF 200 337 3e-25 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185886
Predicted Effect probably benign
Transcript: ENSMUST00000187049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187105
Predicted Effect unknown
Transcript: ENSMUST00000187231
AA Change: R85H
Predicted Effect probably benign
Transcript: ENSMUST00000187306
SMART Domains Protein: ENSMUSP00000139834
Gene: ENSMUSG00000026309

DomainStartEndE-ValueType
Blast:PP2Cc 7 73 2e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000187678
Predicted Effect probably damaging
Transcript: ENSMUST00000190747
AA Change: R103H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140905
Gene: ENSMUSG00000026309
AA Change: R103H

DomainStartEndE-ValueType
PP2Cc 1 164 7.3e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191230
Meta Mutation Damage Score 0.42 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protein serine/threonine phosphatase of the PP2C family. This protein can interact with integrin-linked kinase (ILK/ILK1), a regulator of integrin mediated signaling, and regulate the kinase activity of ILK. Through the interaction with ILK, this protein may selectively affect the signaling process of ILK-mediated glycogen synthase kinase 3 beta (GSK3beta), and thus participate in Wnt signaling pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null gene trap insertion exhibit enhanced motor coordination, and male homozygous mice exhibit increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Ilkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Ilkap APN 1 91385238 critical splice donor site probably null
PIT4445001:Ilkap UTSW 1 91385345 missense probably benign
R0184:Ilkap UTSW 1 91376305 unclassified probably benign
R1366:Ilkap UTSW 1 91387215 missense possibly damaging 0.58
R1552:Ilkap UTSW 1 91384594 missense probably damaging 1.00
R2155:Ilkap UTSW 1 91384623 missense possibly damaging 0.65
R3946:Ilkap UTSW 1 91387250 missense probably damaging 1.00
R4005:Ilkap UTSW 1 91385263 missense probably benign 0.03
R4860:Ilkap UTSW 1 91387383 unclassified probably benign
R5666:Ilkap UTSW 1 91391141 missense probably benign 0.38
R5670:Ilkap UTSW 1 91391141 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CTGGAATGGATGCCTCTAAAGCCTC -3'
(R):5'- CAACAGTTAGGTTGGATGGTGCCC -3'

Sequencing Primer
(F):5'- TTCCTGTGATAAAGCAAGCATCC -3'
(R):5'- ggtggtggtggtgagtg -3'
Posted On2013-10-16