Incidental Mutation 'R0782:Dhx36'
ID 76673
Institutional Source Beutler Lab
Gene Symbol Dhx36
Ensembl Gene ENSMUSG00000027770
Gene Name DEAH-box helicase 36
Synonyms 2810407E23Rik, Ddx36, RHAU
MMRRC Submission 038962-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0782 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 62375434-62414425 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 62414135 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029336]
AlphaFold Q8VHK9
Predicted Effect probably benign
Transcript: ENSMUST00000029336
SMART Domains Protein: ENSMUSP00000029336
Gene: ENSMUSG00000027770

DomainStartEndE-ValueType
low complexity region 10 45 N/A INTRINSIC
DEXDc 198 389 1.53e-31 SMART
HELICc 495 600 5.61e-16 SMART
HA2 662 753 2.23e-26 SMART
Pfam:OB_NTP_bind 792 910 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192223
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH-box family of RNA-dependent NTPases which are named after the conserved amino acid sequence Asp-Glu-Ala-His in motif II. The protein encoded by this gene has been shown to enhance the deadenylation and decay of mRNAs with 3'-UTR AU-rich elements (ARE-mRNA). The protein has also been shown to resolve into single strands the highly stable tetramolecular DNA configuration (G4) that can form spontaneously in guanine-rich regions of DNA. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality around E7.0. Mice homozygous for a conditional allele activated in the hematopoiesis systemexhibit impaired erythropoiesis associated with cell cycle defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,391,380 (GRCm39) P1299L possibly damaging Het
B3glct C T 5: 149,650,275 (GRCm39) T126M probably damaging Het
Baz1a A T 12: 54,941,273 (GRCm39) D1492E probably damaging Het
Cdc14a A G 3: 116,115,785 (GRCm39) I259T probably damaging Het
Cog7 C A 7: 121,543,020 (GRCm39) A464S possibly damaging Het
Csf2rb2 C A 15: 78,170,951 (GRCm39) K368N probably damaging Het
Cspp1 T A 1: 10,200,199 (GRCm39) probably benign Het
Cyp2c37 A G 19: 39,982,269 (GRCm39) H90R probably benign Het
Dcst1 A G 3: 89,264,807 (GRCm39) F314L possibly damaging Het
Efr3b G A 12: 4,034,686 (GRCm39) probably benign Het
Faap100 A G 11: 120,267,530 (GRCm39) probably null Het
Hmcn1 A G 1: 150,629,416 (GRCm39) I947T possibly damaging Het
Ilkap C T 1: 91,306,272 (GRCm39) R103H probably damaging Het
Impa1 A T 3: 10,387,956 (GRCm39) probably benign Het
Kbtbd8 C T 6: 95,099,213 (GRCm39) R164C probably damaging Het
Lactb2 T G 1: 13,717,675 (GRCm39) N116T probably benign Het
Myh8 T A 11: 67,180,580 (GRCm39) N605K probably benign Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Napa T C 7: 15,849,192 (GRCm39) M244T probably benign Het
Nckap5 G A 1: 125,909,278 (GRCm39) S1719F probably damaging Het
Nfe2l2 T C 2: 75,507,177 (GRCm39) I308V probably benign Het
Or51af1 C A 7: 103,141,722 (GRCm39) R121L probably damaging Het
Ppfia2 C T 10: 106,763,592 (GRCm39) S1195L probably benign Het
Rasa4 A G 5: 136,133,386 (GRCm39) K615R possibly damaging Het
Rnf216 T C 5: 143,054,647 (GRCm39) K634E possibly damaging Het
Samd3 A G 10: 26,146,138 (GRCm39) T388A probably damaging Het
Serping1 G A 2: 84,597,790 (GRCm39) P364S probably damaging Het
Slc39a10 T C 1: 46,875,156 (GRCm39) S49G probably damaging Het
Smc2 C A 4: 52,469,799 (GRCm39) T762K probably benign Het
Smpd1 T A 7: 105,204,550 (GRCm39) V143E possibly damaging Het
Synj2bp A T 12: 81,579,507 (GRCm39) L16Q probably damaging Het
Tcof1 G A 18: 60,949,352 (GRCm39) R1188W probably damaging Het
Unc80 A G 1: 66,661,740 (GRCm39) R1722G possibly damaging Het
Vamp5 T C 6: 72,346,453 (GRCm39) S48G probably damaging Het
Vps13d G A 4: 144,853,195 (GRCm39) probably benign Het
Zfp292 T C 4: 34,839,382 (GRCm39) N161S possibly damaging Het
Zfp831 A G 2: 174,488,423 (GRCm39) T1033A probably benign Het
Other mutations in Dhx36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dhx36 APN 3 62,377,979 (GRCm39) utr 3 prime probably benign
IGL00538:Dhx36 APN 3 62,408,466 (GRCm39) missense probably benign 0.04
IGL00706:Dhx36 APN 3 62,404,263 (GRCm39) missense probably damaging 1.00
IGL02040:Dhx36 APN 3 62,408,436 (GRCm39) missense probably benign
IGL02141:Dhx36 APN 3 62,401,310 (GRCm39) missense probably benign 0.25
IGL02514:Dhx36 APN 3 62,408,319 (GRCm39) missense possibly damaging 0.63
IGL02540:Dhx36 APN 3 62,414,309 (GRCm39) missense probably benign 0.07
IGL02629:Dhx36 APN 3 62,414,155 (GRCm39) missense probably benign 0.01
IGL02858:Dhx36 APN 3 62,384,797 (GRCm39) splice site probably benign
IGL03305:Dhx36 APN 3 62,408,257 (GRCm39) nonsense probably null
bundeswehr UTSW 3 62,386,747 (GRCm39) missense probably benign
R0002:Dhx36 UTSW 3 62,388,260 (GRCm39) missense probably damaging 1.00
R0002:Dhx36 UTSW 3 62,388,260 (GRCm39) missense probably damaging 1.00
R0021:Dhx36 UTSW 3 62,385,016 (GRCm39) missense possibly damaging 0.66
R0021:Dhx36 UTSW 3 62,385,016 (GRCm39) missense possibly damaging 0.66
R0671:Dhx36 UTSW 3 62,401,162 (GRCm39) missense possibly damaging 0.96
R0735:Dhx36 UTSW 3 62,380,150 (GRCm39) missense probably benign 0.00
R1725:Dhx36 UTSW 3 62,414,360 (GRCm39) start codon destroyed probably benign 0.01
R1951:Dhx36 UTSW 3 62,391,694 (GRCm39) missense probably damaging 0.99
R1959:Dhx36 UTSW 3 62,386,806 (GRCm39) missense probably benign 0.01
R2257:Dhx36 UTSW 3 62,385,064 (GRCm39) missense probably damaging 1.00
R2397:Dhx36 UTSW 3 62,405,518 (GRCm39) missense probably benign 0.00
R2484:Dhx36 UTSW 3 62,380,236 (GRCm39) missense probably damaging 0.96
R2973:Dhx36 UTSW 3 62,402,919 (GRCm39) missense possibly damaging 0.56
R2973:Dhx36 UTSW 3 62,402,916 (GRCm39) missense probably benign 0.00
R3617:Dhx36 UTSW 3 62,394,481 (GRCm39) missense probably benign 0.01
R3617:Dhx36 UTSW 3 62,379,428 (GRCm39) missense possibly damaging 0.96
R3725:Dhx36 UTSW 3 62,395,643 (GRCm39) splice site probably benign
R3898:Dhx36 UTSW 3 62,399,790 (GRCm39) missense probably damaging 0.98
R4332:Dhx36 UTSW 3 62,392,412 (GRCm39) missense probably damaging 1.00
R4359:Dhx36 UTSW 3 62,382,699 (GRCm39) missense probably benign 0.05
R4493:Dhx36 UTSW 3 62,395,925 (GRCm39) intron probably benign
R4652:Dhx36 UTSW 3 62,408,419 (GRCm39) missense probably benign 0.01
R4866:Dhx36 UTSW 3 62,380,198 (GRCm39) missense probably damaging 1.00
R4884:Dhx36 UTSW 3 62,391,681 (GRCm39) missense probably damaging 1.00
R4960:Dhx36 UTSW 3 62,404,280 (GRCm39) missense probably damaging 1.00
R5083:Dhx36 UTSW 3 62,379,420 (GRCm39) missense probably benign 0.17
R5162:Dhx36 UTSW 3 62,401,201 (GRCm39) missense probably damaging 1.00
R5815:Dhx36 UTSW 3 62,401,176 (GRCm39) missense probably damaging 1.00
R6090:Dhx36 UTSW 3 62,404,241 (GRCm39) missense probably damaging 0.98
R6392:Dhx36 UTSW 3 62,401,790 (GRCm39) missense probably benign 0.00
R6433:Dhx36 UTSW 3 62,392,395 (GRCm39) missense probably damaging 1.00
R6504:Dhx36 UTSW 3 62,396,060 (GRCm39) missense probably benign
R6615:Dhx36 UTSW 3 62,396,338 (GRCm39) missense probably benign
R6672:Dhx36 UTSW 3 62,408,300 (GRCm39) missense probably benign 0.00
R6672:Dhx36 UTSW 3 62,402,957 (GRCm39) missense probably damaging 1.00
R7172:Dhx36 UTSW 3 62,408,436 (GRCm39) missense probably benign
R7302:Dhx36 UTSW 3 62,386,814 (GRCm39) missense probably benign
R7487:Dhx36 UTSW 3 62,391,623 (GRCm39) missense possibly damaging 0.91
R7515:Dhx36 UTSW 3 62,379,508 (GRCm39) missense probably benign 0.45
R7531:Dhx36 UTSW 3 62,392,389 (GRCm39) missense probably damaging 1.00
R7579:Dhx36 UTSW 3 62,388,294 (GRCm39) missense possibly damaging 0.64
R7726:Dhx36 UTSW 3 62,396,389 (GRCm39) missense probably benign 0.01
R7874:Dhx36 UTSW 3 62,396,052 (GRCm39) missense probably benign
R8056:Dhx36 UTSW 3 62,396,012 (GRCm39) missense possibly damaging 0.93
R8226:Dhx36 UTSW 3 62,377,991 (GRCm39) missense probably benign 0.01
R8361:Dhx36 UTSW 3 62,388,221 (GRCm39) critical splice donor site probably null
R8529:Dhx36 UTSW 3 62,414,277 (GRCm39) small deletion probably benign
R8737:Dhx36 UTSW 3 62,386,747 (GRCm39) missense probably benign
R8947:Dhx36 UTSW 3 62,380,387 (GRCm39) missense probably benign
R9098:Dhx36 UTSW 3 62,414,142 (GRCm39) missense probably benign 0.00
R9098:Dhx36 UTSW 3 62,414,141 (GRCm39) nonsense probably null
R9209:Dhx36 UTSW 3 62,378,895 (GRCm39) missense probably benign 0.21
R9718:Dhx36 UTSW 3 62,379,466 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACCCTCAGTTCAGTTCTCAAGTCCG -3'
(R):5'- TGCTTGTGACACTCAACGTCCC -3'

Sequencing Primer
(F):5'- GTTCTCAAGTCCGTAAACAGAG -3'
(R):5'- CTACGACTATCATCAGAGCTGGAG -3'
Posted On 2013-10-16