Incidental Mutation 'R0782:Dcst1'
ID76674
Institutional Source Beutler Lab
Gene Symbol Dcst1
Ensembl Gene ENSMUSG00000042672
Gene NameDC-STAMP domain containing 1
Synonyms
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0782 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89350219-89365253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89357500 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 314 (F314L)
Ref Sequence ENSEMBL: ENSMUSP00000065502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070820] [ENSMUST00000208216]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070820
AA Change: F314L

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065502
Gene: ENSMUSG00000042672
AA Change: F314L

DomainStartEndE-ValueType
coiled coil region 18 44 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 108 125 N/A INTRINSIC
transmembrane domain 398 420 N/A INTRINSIC
Pfam:DC_STAMP 431 621 1.5e-55 PFAM
Blast:RING 672 710 3e-17 BLAST
SCOP:d1ldjb_ 672 710 2e-3 SMART
low complexity region 717 728 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200174
Predicted Effect probably benign
Transcript: ENSMUST00000208216
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein. A similar gene in human has been associated with dendritic cells. [provided by RefSeq, May 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Dcst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02373:Dcst1 APN 3 89357891 missense probably damaging 0.98
R0722:Dcst1 UTSW 3 89353805 missense probably benign 0.04
R0891:Dcst1 UTSW 3 89353277 missense probably benign 0.16
R1434:Dcst1 UTSW 3 89352519 missense probably damaging 1.00
R1807:Dcst1 UTSW 3 89353541 missense probably damaging 1.00
R1831:Dcst1 UTSW 3 89352750 missense probably damaging 0.98
R2129:Dcst1 UTSW 3 89357545 missense probably damaging 0.97
R2371:Dcst1 UTSW 3 89358642 missense possibly damaging 0.47
R4600:Dcst1 UTSW 3 89356336 missense probably benign 0.01
R4761:Dcst1 UTSW 3 89357553 missense possibly damaging 0.83
R4906:Dcst1 UTSW 3 89350507 missense possibly damaging 0.85
R4974:Dcst1 UTSW 3 89357803 missense probably benign 0.27
R5552:Dcst1 UTSW 3 89365066 missense probably benign 0.03
R5910:Dcst1 UTSW 3 89350424 missense possibly damaging 0.94
R5943:Dcst1 UTSW 3 89356411 splice site probably null
R5992:Dcst1 UTSW 3 89352576 missense probably damaging 1.00
R6630:Dcst1 UTSW 3 89364326 missense possibly damaging 0.75
R6685:Dcst1 UTSW 3 89356873 missense possibly damaging 0.49
R6877:Dcst1 UTSW 3 89350360 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTCACTACAGAGCCGTCAGTAGGG -3'
(R):5'- CACACAGATGGTGTATGAGCTGAGG -3'

Sequencing Primer
(F):5'- TCAGTAGGGAGTGAACTTATGTACC -3'
(R):5'- GTATTCCTGAGCAGGGCAG -3'
Posted On2013-10-16