Incidental Mutation 'R0782:Rasa4'
ID76679
Institutional Source Beutler Lab
Gene Symbol Rasa4
Ensembl Gene ENSMUSG00000004952
Gene NameRAS p21 protein activator 4
Synonyms
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R0782 (G1)
Quality Score142
Status Validated
Chromosome5
Chromosomal Location136083916-136111860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136104532 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 615 (K615R)
Ref Sequence ENSEMBL: ENSMUSP00000037869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042135] [ENSMUST00000100570]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042135
AA Change: K615R

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037869
Gene: ENSMUSG00000004952
AA Change: K615R

DomainStartEndE-ValueType
C2 6 103 5.43e-17 SMART
C2 134 231 1.78e-21 SMART
RasGAP 243 604 3.47e-139 SMART
PH 566 674 1.81e-11 SMART
BTK 674 710 3.6e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100570
AA Change: K569R

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098136
Gene: ENSMUSG00000004952
AA Change: K569R

DomainStartEndE-ValueType
C2 6 103 5.43e-17 SMART
C2 134 231 1.78e-21 SMART
RasGAP 243 558 3.48e-89 SMART
PH 520 628 1.81e-11 SMART
BTK 628 664 3.6e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000122887
AA Change: K43R
SMART Domains Protein: ENSMUSP00000118929
Gene: ENSMUSG00000004952
AA Change: K43R

DomainStartEndE-ValueType
PH 6 103 1.36e-6 SMART
BTK 103 141 5.56e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140972
Predicted Effect probably benign
Transcript: ENSMUST00000145294
SMART Domains Protein: ENSMUSP00000120203
Gene: ENSMUSG00000004952

DomainStartEndE-ValueType
C2 5 68 1.88e-2 SMART
Blast:RasGAP 80 121 7e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184713
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GAP1 family of GTPase-activating proteins that suppresses the Ras/mitogen-activated protein kinase pathway in response to Ca(2+). Stimuli that increase intracellular Ca(2+) levels result in the translocation of this protein to the plasma membrane, where it activates Ras GTPase activity. Consequently, Ras is converted from the active GTP-bound state to the inactive GDP-bound state and no longer activates downstream pathways that regulate gene expression, cell growth, and differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an increased sensitivity to bacterial infections which involves reduced phagocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Rasa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rasa4 APN 5 136101993 missense possibly damaging 0.95
IGL01364:Rasa4 APN 5 136095571 missense possibly damaging 0.83
IGL01835:Rasa4 APN 5 136102607 missense possibly damaging 0.95
IGL02284:Rasa4 APN 5 136101691 critical splice donor site probably null
IGL02332:Rasa4 APN 5 136095599 missense probably benign 0.02
IGL03197:Rasa4 APN 5 136102012 missense probably damaging 1.00
R0729:Rasa4 UTSW 5 136102070 splice site probably benign
R1124:Rasa4 UTSW 5 136105656 missense probably benign 0.07
R1673:Rasa4 UTSW 5 136104637 missense probably benign 0.12
R1902:Rasa4 UTSW 5 136091238 missense probably benign 0.01
R2357:Rasa4 UTSW 5 136091247 missense probably damaging 1.00
R2427:Rasa4 UTSW 5 136102027 missense probably benign 0.24
R2880:Rasa4 UTSW 5 136091771 missense probably damaging 1.00
R3818:Rasa4 UTSW 5 136102293 missense possibly damaging 0.65
R4647:Rasa4 UTSW 5 136101363 missense probably damaging 1.00
R4782:Rasa4 UTSW 5 136091229 nonsense probably null
R4837:Rasa4 UTSW 5 136091810 critical splice donor site probably null
R4863:Rasa4 UTSW 5 136103911 nonsense probably null
R5020:Rasa4 UTSW 5 136101299 missense probably damaging 1.00
R5729:Rasa4 UTSW 5 136093162 missense probably benign
R6606:Rasa4 UTSW 5 136103947 missense probably damaging 1.00
R6750:Rasa4 UTSW 5 136100948 missense probably benign 0.12
R7009:Rasa4 UTSW 5 136101363 missense probably damaging 1.00
R7158:Rasa4 UTSW 5 136102021 missense probably damaging 0.99
R7358:Rasa4 UTSW 5 136095594 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACTCTGGCTGAGATCCCTTCAC -3'
(R):5'- TTTCTAGGCATGAGACCCCAGGAC -3'

Sequencing Primer
(F):5'- TGAGATCCCTTCACAGAGCAG -3'
(R):5'- GTACCTAATCTAGCCAACAGGGG -3'
Posted On2013-10-16