Incidental Mutation 'R0782:Rnf216'
ID76680
Institutional Source Beutler Lab
Gene Symbol Rnf216
Ensembl Gene ENSMUSG00000045078
Gene Namering finger protein 216
Synonyms2810055G22Rik, Ubce7ip1, F830018F18Rik, UIP83
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0782 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location142990893-143112994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143068892 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 634 (K634E)
Ref Sequence ENSEMBL: ENSMUSP00000143705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053498] [ENSMUST00000197296] [ENSMUST00000200430] [ENSMUST00000200607]
Predicted Effect probably benign
Transcript: ENSMUST00000053498
AA Change: K577E

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052563
Gene: ENSMUSG00000045078
AA Change: K577E

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200421
Predicted Effect probably benign
Transcript: ENSMUST00000200430
Predicted Effect possibly damaging
Transcript: ENSMUST00000200607
AA Change: K634E

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143705
Gene: ENSMUSG00000045078
AA Change: K634E

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which specifically colocalizes and interacts with the serine/threonine protein kinase, receptor-interacting protein (RIP). Zinc finger domains of the encoded protein are required for its interaction with RIP and for inhibition of TNF- and IL1-induced NF-kappa B activation pathways. The encoded protein may also function as an E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes and transfers it to substrates. Several alternatively spliced transcript variants have been described for this locus but the full-length natures of only some are known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Rnf216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Rnf216 APN 5 143068910 missense possibly damaging 0.67
IGL02502:Rnf216 APN 5 143068867 missense probably damaging 1.00
IGL02536:Rnf216 APN 5 143080240 missense probably benign 0.04
IGL03196:Rnf216 APN 5 143081011 missense probably damaging 1.00
PIT4445001:Rnf216 UTSW 5 143086003 missense probably damaging 1.00
R0270:Rnf216 UTSW 5 143080241 missense possibly damaging 0.63
R0422:Rnf216 UTSW 5 143015654 nonsense probably null
R0422:Rnf216 UTSW 5 143090370 missense probably benign 0.15
R1109:Rnf216 UTSW 5 143068369 missense probably damaging 1.00
R1917:Rnf216 UTSW 5 142992806 missense probably benign 0.03
R2233:Rnf216 UTSW 5 143090926 missense probably benign
R2234:Rnf216 UTSW 5 143090926 missense probably benign
R2235:Rnf216 UTSW 5 143090926 missense probably benign
R2340:Rnf216 UTSW 5 143080334 missense probably damaging 0.99
R3015:Rnf216 UTSW 5 143075725 critical splice donor site probably null
R3726:Rnf216 UTSW 5 143027946 missense probably damaging 0.96
R4231:Rnf216 UTSW 5 143093090 missense probably damaging 1.00
R4885:Rnf216 UTSW 5 143090580 nonsense probably null
R4942:Rnf216 UTSW 5 143093059 missense probably damaging 1.00
R4973:Rnf216 UTSW 5 143090316 missense probably benign
R5291:Rnf216 UTSW 5 143090212 missense probably benign
R5307:Rnf216 UTSW 5 143093002 missense probably damaging 1.00
R5328:Rnf216 UTSW 5 143092999 missense possibly damaging 0.84
R5416:Rnf216 UTSW 5 143015771 nonsense probably null
R5888:Rnf216 UTSW 5 143068314 splice site probably null
R6048:Rnf216 UTSW 5 143068904 missense probably damaging 1.00
R6451:Rnf216 UTSW 5 142992834 missense possibly damaging 0.80
R6595:Rnf216 UTSW 5 143090657 missense probably benign 0.00
R7422:Rnf216 UTSW 5 143090836 missense probably benign 0.01
R7470:Rnf216 UTSW 5 142992725 missense possibly damaging 0.88
R7504:Rnf216 UTSW 5 143075759 missense not run
R7507:Rnf216 UTSW 5 143089802 missense not run
Predicted Primers PCR Primer
(F):5'- CTGCACTTACAGGGACAACACAGG -3'
(R):5'- ATCGGAGGAGAAGGGCTTTGCTAC -3'

Sequencing Primer
(F):5'- CAGAGCCATCGATAGATGCTTTC -3'
(R):5'- GTCCCTCCCCTTGAAAGATG -3'
Posted On2013-10-16