Incidental Mutation 'R0782:Samd3'
ID76688
Institutional Source Beutler Lab
Gene Symbol Samd3
Ensembl Gene ENSMUSG00000051354
Gene Namesterile alpha motif domain containing 3
SynonymsLOC268288
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R0782 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location26229707-26272172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26270240 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 388 (T388A)
Ref Sequence ENSEMBL: ENSMUSP00000151558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000060716] [ENSMUST00000105519] [ENSMUST00000220219]
Predicted Effect probably benign
Transcript: ENSMUST00000040219
SMART Domains Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060716
AA Change: T388A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057805
Gene: ENSMUSG00000051354
AA Change: T388A

DomainStartEndE-ValueType
SAM 1 66 3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105519
SMART Domains Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089

DomainStartEndE-ValueType
low complexity region 129 141 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
MBT 207 307 3.75e-48 SMART
MBT 315 414 3.67e-42 SMART
MBT 423 518 7.5e-48 SMART
low complexity region 579 590 N/A INTRINSIC
low complexity region 637 745 N/A INTRINSIC
SAM 783 850 2.49e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218585
Predicted Effect unknown
Transcript: ENSMUST00000219738
AA Change: T61A
Predicted Effect probably damaging
Transcript: ENSMUST00000220219
AA Change: T388A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Samd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Samd3 APN 10 26251846 missense probably damaging 1.00
IGL00754:Samd3 APN 10 26244527 missense probably benign 0.19
IGL01672:Samd3 APN 10 26270169 missense possibly damaging 0.94
IGL02211:Samd3 APN 10 26233557 missense probably damaging 1.00
IGL02397:Samd3 APN 10 26233576 missense possibly damaging 0.85
IGL02755:Samd3 APN 10 26244577 missense probably damaging 1.00
IGL02885:Samd3 APN 10 26271864 missense probably benign 0.43
IGL03115:Samd3 APN 10 26271708 missense probably damaging 1.00
IGL03157:Samd3 APN 10 26263842 missense probably benign 0.05
IGL03172:Samd3 APN 10 26230166 missense probably damaging 1.00
R0034:Samd3 UTSW 10 26271500 splice site probably benign
R0081:Samd3 UTSW 10 26271501 splice site probably benign
R0197:Samd3 UTSW 10 26271854 missense possibly damaging 0.77
R0566:Samd3 UTSW 10 26244498 missense possibly damaging 0.83
R0632:Samd3 UTSW 10 26244495 missense possibly damaging 0.86
R0834:Samd3 UTSW 10 26271827 missense probably benign 0.01
R1106:Samd3 UTSW 10 26271791 missense possibly damaging 0.57
R1844:Samd3 UTSW 10 26251774 missense probably damaging 1.00
R1907:Samd3 UTSW 10 26271856 nonsense probably null
R1929:Samd3 UTSW 10 26263986 splice site probably benign
R2925:Samd3 UTSW 10 26251887 missense probably benign 0.37
R5104:Samd3 UTSW 10 26263788 missense possibly damaging 0.61
R5736:Samd3 UTSW 10 26270172 missense probably damaging 1.00
R7120:Samd3 UTSW 10 26230966 missense possibly damaging 0.77
R7437:Samd3 UTSW 10 26270106 missense possibly damaging 0.78
R7510:Samd3 UTSW 10 26230108 missense not run
Predicted Primers PCR Primer
(F):5'- GATGATGCTAACCAGCTATCCACCC -3'
(R):5'- CTGCCAGATCTTAATGGTGGTCAGC -3'

Sequencing Primer
(F):5'- AATAACCTTTTCTTGTGACCTGG -3'
(R):5'- GCTGAGAATCTGCTCCCAAT -3'
Posted On2013-10-16