Incidental Mutation 'R0782:Synj2bp'
ID76694
Institutional Source Beutler Lab
Gene Symbol Synj2bp
Ensembl Gene ENSMUSG00000090935
Gene Namesynaptojanin 2 binding protein
SynonymsOMP25, ARIP2, activin receptor interacting protein 2, D12Wsu118e
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R0782 (G1)
Quality Score189
Status Validated
Chromosome12
Chromosomal Location81497941-81532911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81532733 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 16 (L16Q)
Ref Sequence ENSEMBL: ENSMUSP00000130691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163402] [ENSMUST00000164386] [ENSMUST00000164431] [ENSMUST00000166664] [ENSMUST00000169158] [ENSMUST00000171459]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110339
SMART Domains Protein: ENSMUSP00000105968
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163402
AA Change: L16Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129224
Gene: ENSMUSG00000090935
AA Change: L16Q

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164386
AA Change: L16Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139
AA Change: L16Q

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000164431
AA Change: L16Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165200
Predicted Effect probably damaging
Transcript: ENSMUST00000166664
AA Change: L16Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131728
Gene: ENSMUSG00000021139
AA Change: L16Q

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168961
Predicted Effect probably damaging
Transcript: ENSMUST00000169158
AA Change: L16Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130691
Gene: ENSMUSG00000090935
AA Change: L16Q

DomainStartEndE-ValueType
PDZ 21 100 5e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170958
Predicted Effect unknown
Transcript: ENSMUST00000171459
AA Change: L16Q
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Synj2bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2104:Synj2bp UTSW 12 81502052 missense probably benign 0.12
R4825:Synj2bp UTSW 12 81502152 missense probably damaging 0.98
R7166:Synj2bp UTSW 12 81504515 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCGACTGGATTATGGGGCAGAG -3'
(R):5'- TCAGGATCGGCCTTGAGAACAGTG -3'

Sequencing Primer
(F):5'- GGGTCCGTTATCTAGCTAACAAAAG -3'
(R):5'- GGGCTCAGAGAACCACCAC -3'
Posted On2013-10-16