Incidental Mutation 'R0782:Csf2rb2'
ID76695
Institutional Source Beutler Lab
Gene Symbol Csf2rb2
Ensembl Gene ENSMUSG00000071714
Gene Namecolony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage)
SynonymsBil3, AIC2A, Il3r, Il3rb2, BetaIl3
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0782 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78282507-78305721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78286751 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 368 (K368N)
Ref Sequence ENSEMBL: ENSMUSP00000155013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096356] [ENSMUST00000230115]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096356
AA Change: K477N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094083
Gene: ENSMUSG00000071714
AA Change: K477N

DomainStartEndE-ValueType
SCOP:d1gh7a1 29 131 1e-57 SMART
FN3 137 225 3.73e-1 SMART
Pfam:IL6Ra-bind 248 342 6.3e-11 PFAM
FN3 343 425 2.83e0 SMART
transmembrane domain 445 467 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183491
Predicted Effect probably damaging
Transcript: ENSMUST00000230115
AA Change: K368N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000230753
Meta Mutation Damage Score 0.0236 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation are apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Csf2rb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Csf2rb2 APN 15 78284847 missense possibly damaging 0.78
IGL00765:Csf2rb2 APN 15 78292716 missense probably benign 0.17
IGL01383:Csf2rb2 APN 15 78297043 missense possibly damaging 0.90
IGL01975:Csf2rb2 APN 15 78288886 missense probably benign 0.01
IGL02330:Csf2rb2 APN 15 78285128 missense possibly damaging 0.85
IGL02365:Csf2rb2 APN 15 78287060 missense possibly damaging 0.92
IGL02756:Csf2rb2 APN 15 78284849 missense possibly damaging 0.95
R0269:Csf2rb2 UTSW 15 78288865 missense probably benign 0.09
R0462:Csf2rb2 UTSW 15 78285173 missense probably damaging 1.00
R0540:Csf2rb2 UTSW 15 78287908 missense probably benign 0.00
R0607:Csf2rb2 UTSW 15 78287908 missense probably benign 0.00
R0636:Csf2rb2 UTSW 15 78291960 nonsense probably null
R1387:Csf2rb2 UTSW 15 78298214 missense probably damaging 0.99
R1799:Csf2rb2 UTSW 15 78297068 missense probably damaging 1.00
R1881:Csf2rb2 UTSW 15 78292535 intron probably null
R2079:Csf2rb2 UTSW 15 78288007 missense probably benign 0.13
R2108:Csf2rb2 UTSW 15 78292544 missense probably damaging 0.99
R2359:Csf2rb2 UTSW 15 78292776 missense probably benign 0.39
R4614:Csf2rb2 UTSW 15 78291702 missense probably damaging 1.00
R4806:Csf2rb2 UTSW 15 78285290 missense probably benign 0.11
R4900:Csf2rb2 UTSW 15 78285974 splice site probably null
R5206:Csf2rb2 UTSW 15 78292752 missense probably benign
R5270:Csf2rb2 UTSW 15 78291982 splice site probably null
R5427:Csf2rb2 UTSW 15 78288911 missense probably damaging 1.00
R6633:Csf2rb2 UTSW 15 78288952 missense probably benign 0.00
R7067:Csf2rb2 UTSW 15 78292494 missense probably damaging 1.00
R7102:Csf2rb2 UTSW 15 78297072 missense probably damaging 1.00
R7117:Csf2rb2 UTSW 15 78285185 missense probably damaging 1.00
R7423:Csf2rb2 UTSW 15 78292560 missense possibly damaging 0.65
R7453:Csf2rb2 UTSW 15 78285291 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGCCGACTCTTCTGAGCCATTTTG -3'
(R):5'- TGGATACACTCTCGTTCCCAGCAC -3'

Sequencing Primer
(F):5'- AGGCCAATTTGTGAGACTCC -3'
(R):5'- CGTTCCCAGCACACCATTC -3'
Posted On2013-10-16