Incidental Mutation 'R0782:Cyp2c37'
ID76698
Institutional Source Beutler Lab
Gene Symbol Cyp2c37
Ensembl Gene ENSMUSG00000042248
Gene Namecytochrome P450, family 2. subfamily c, polypeptide 37
Synonyms
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0782 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39992424-40012243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39993825 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 90 (H90R)
Ref Sequence ENSEMBL: ENSMUSP00000045362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049178]
Predicted Effect probably benign
Transcript: ENSMUST00000049178
AA Change: H90R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000045362
Gene: ENSMUSG00000042248
AA Change: H90R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 5e-160 PFAM
Meta Mutation Damage Score 0.1228 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Cyp2c37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Cyp2c37 APN 19 40001997 missense probably benign 0.00
IGL01307:Cyp2c37 APN 19 39992579 missense probably benign 0.00
IGL01959:Cyp2c37 APN 19 39995833 nonsense probably null
IGL02580:Cyp2c37 APN 19 39994498 missense probably damaging 1.00
IGL02611:Cyp2c37 APN 19 39993865 missense probably benign 0.00
R0124:Cyp2c37 UTSW 19 39994102 missense probably damaging 1.00
R0391:Cyp2c37 UTSW 19 39994506 missense probably damaging 1.00
R0420:Cyp2c37 UTSW 19 39995794 missense probably benign 0.00
R1413:Cyp2c37 UTSW 19 39994098 missense probably benign 0.21
R1637:Cyp2c37 UTSW 19 40001982 nonsense probably null
R1688:Cyp2c37 UTSW 19 39994443 splice site probably null
R2258:Cyp2c37 UTSW 19 39995859 missense possibly damaging 0.49
R4353:Cyp2c37 UTSW 19 40000545 missense possibly damaging 0.66
R4640:Cyp2c37 UTSW 19 40011832 missense possibly damaging 0.67
R4965:Cyp2c37 UTSW 19 40011762 missense possibly damaging 0.79
R5053:Cyp2c37 UTSW 19 40001887 missense probably benign 0.00
R5645:Cyp2c37 UTSW 19 39994152 missense probably benign 0.04
R5847:Cyp2c37 UTSW 19 40011732 missense probably damaging 0.98
R6487:Cyp2c37 UTSW 19 39994581 missense probably benign
R6631:Cyp2c37 UTSW 19 40009843 missense probably damaging 1.00
R7062:Cyp2c37 UTSW 19 39995546 intron probably null
Predicted Primers PCR Primer
(F):5'- TGTGTGAAGTGAGCATGAGCATCC -3'
(R):5'- AGCGTCATGAGTGAGAAACGCC -3'

Sequencing Primer
(F):5'- TTTGCAATAGTGCCCTAGAAATG -3'
(R):5'- CACTCAGTAGAGAGTACATCCTG -3'
Posted On2013-10-16