Incidental Mutation 'R0784:Dennd1a'
ID76747
Institutional Source Beutler Lab
Gene Symbol Dennd1a
Ensembl Gene ENSMUSG00000035392
Gene NameDENN/MADD domain containing 1A
Synonyms6030446I19Rik
MMRRC Submission 038964-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R0784 (G1)
Quality Score219
Status Validated
Chromosome2
Chromosomal Location37798991-38287390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38021414 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 187 (L187P)
Ref Sequence ENSEMBL: ENSMUSP00000099848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102787] [ENSMUST00000130472] [ENSMUST00000140552] [ENSMUST00000150896]
Predicted Effect probably damaging
Transcript: ENSMUST00000102787
AA Change: L187P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099848
Gene: ENSMUSG00000035392
AA Change: L187P

DomainStartEndE-ValueType
uDENN 9 91 1.44e-26 SMART
DENN 92 273 2.09e-73 SMART
dDENN 304 371 1.37e-18 SMART
low complexity region 497 508 N/A INTRINSIC
low complexity region 689 702 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 801 815 N/A INTRINSIC
low complexity region 822 856 N/A INTRINSIC
low complexity region 952 972 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126889
Predicted Effect probably benign
Transcript: ENSMUST00000130472
SMART Domains Protein: ENSMUSP00000119892
Gene: ENSMUSG00000035392

DomainStartEndE-ValueType
Blast:uDENN 9 64 4e-20 BLAST
PDB:3TW8|C 44 105 3e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000140552
Predicted Effect probably benign
Transcript: ENSMUST00000150896
SMART Domains Protein: ENSMUSP00000116723
Gene: ENSMUSG00000035392

DomainStartEndE-ValueType
uDENN 9 91 1.44e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204461
Meta Mutation Damage Score 0.56 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.1%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1A, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,653,528 probably benign Het
Adamts2 C T 11: 50,668,003 R182W probably damaging Het
Ahr C T 12: 35,508,142 G293D possibly damaging Het
Akna G T 4: 63,376,888 T1028K probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Asic2 T A 11: 80,893,989 M324L possibly damaging Het
Atf6 A G 1: 170,709,947 F635L probably benign Het
Atp8b2 A T 3: 89,957,073 V195E probably damaging Het
Bicd1 T A 6: 149,513,363 C525S probably damaging Het
Cbfa2t3 A G 8: 122,650,487 probably benign Het
Cd46 G A 1: 195,092,194 T11M possibly damaging Het
Cecr2 A G 6: 120,758,149 H754R possibly damaging Het
Clcn3 G T 8: 60,929,203 D450E probably benign Het
Cobl T G 11: 12,266,843 probably benign Het
Cyba T A 8: 122,427,683 T34S probably benign Het
Dennd4c A T 4: 86,844,908 Q1817L probably benign Het
Drosha T C 15: 12,867,678 probably benign Het
Dync1li2 A G 8: 104,442,498 S34P probably damaging Het
Emilin2 T A 17: 71,275,287 D148V possibly damaging Het
Galnt11 A G 5: 25,258,909 D393G probably damaging Het
Gm5435 T A 12: 82,496,180 noncoding transcript Het
Gpr176 C T 2: 118,373,052 V46M possibly damaging Het
Gpr85 T A 6: 13,836,749 H52L probably benign Het
Grn T C 11: 102,434,502 M246T possibly damaging Het
Hnrnpul2 T C 19: 8,825,052 F428L possibly damaging Het
Hoxa13 G C 6: 52,259,937 N278K probably damaging Het
Irx5 A G 8: 92,360,490 D350G probably benign Het
Kat2a C T 11: 100,710,841 M249I probably benign Het
Klhl29 T C 12: 5,081,251 Y782C probably damaging Het
Kmt2c A T 5: 25,310,895 F2650Y probably benign Het
Lrp2 A G 2: 69,518,365 I754T probably benign Het
Mpl G A 4: 118,446,406 P472S possibly damaging Het
Mtnr1b A G 9: 15,862,785 I326T probably benign Het
Myh9 A G 15: 77,777,009 probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo9a A G 9: 59,896,545 probably benign Het
Olfr1187-ps1 T A 2: 88,540,167 noncoding transcript Het
Olfr30 T A 11: 58,455,305 I215F possibly damaging Het
Oraov1 A T 7: 144,919,277 Y108F probably benign Het
Pcsk5 T C 19: 17,714,769 M184V probably benign Het
Piezo2 T A 18: 63,083,235 D1143V probably damaging Het
Prr36 G T 8: 4,213,771 probably benign Het
Rnf220 C A 4: 117,277,998 probably benign Het
Senp3 A G 11: 69,680,448 L131P probably damaging Het
Shc4 A C 2: 125,657,496 W354G probably benign Het
Slc6a15 A G 10: 103,416,800 probably benign Het
Smtnl2 T C 11: 72,399,937 D394G probably damaging Het
Sry G T Y: 2,662,731 Q310K unknown Het
St7l A G 3: 104,870,924 M126V probably benign Het
St8sia3 T C 18: 64,271,701 W350R probably damaging Het
Stk35 A T 2: 129,810,802 K408* probably null Het
Svs1 T A 6: 48,987,301 M81K possibly damaging Het
Thsd7b T C 1: 129,595,359 probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trpm7 A G 2: 126,846,072 probably null Het
Ttf2 T C 3: 100,962,710 D349G probably benign Het
Zfp386 T A 12: 116,059,920 C419* probably null Het
Zfp541 A G 7: 16,082,992 probably benign Het
Other mutations in Dennd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dennd1a APN 2 38243442 nonsense probably null
IGL00490:Dennd1a APN 2 37801152 missense probably damaging 1.00
IGL00839:Dennd1a APN 2 37816982 missense probably benign 0.30
IGL01065:Dennd1a APN 2 37844905 missense probably benign 0.02
IGL01621:Dennd1a APN 2 37844809 missense probably damaging 1.00
IGL01792:Dennd1a APN 2 38126580 missense probably damaging 1.00
IGL01799:Dennd1a APN 2 38048742 missense probably damaging 1.00
IGL02516:Dennd1a APN 2 37852394 critical splice donor site probably null
contract UTSW 2 37852441 missense possibly damaging 0.89
R0018:Dennd1a UTSW 2 37858460 missense possibly damaging 0.72
R0018:Dennd1a UTSW 2 37858460 missense possibly damaging 0.72
R0144:Dennd1a UTSW 2 38126640 missense probably damaging 0.96
R1199:Dennd1a UTSW 2 37961716 missense probably damaging 0.99
R1439:Dennd1a UTSW 2 38043400 missense probably damaging 1.00
R1563:Dennd1a UTSW 2 37858429 missense probably damaging 1.00
R1608:Dennd1a UTSW 2 37852434 missense probably benign 0.18
R1720:Dennd1a UTSW 2 37800197 nonsense probably null
R1967:Dennd1a UTSW 2 37844833 missense probably benign
R2570:Dennd1a UTSW 2 37844783 missense probably damaging 1.00
R3886:Dennd1a UTSW 2 37858077 missense possibly damaging 0.89
R4464:Dennd1a UTSW 2 38243390 splice site probably benign
R4890:Dennd1a UTSW 2 38176226 intron probably benign
R5395:Dennd1a UTSW 2 37802128 missense probably damaging 1.00
R5652:Dennd1a UTSW 2 37801126 missense probably benign 0.00
R5882:Dennd1a UTSW 2 37961663 missense probably damaging 1.00
R6285:Dennd1a UTSW 2 37852441 missense possibly damaging 0.89
R6520:Dennd1a UTSW 2 37961747 splice site probably null
R6934:Dennd1a UTSW 2 37801213 missense possibly damaging 0.62
R7053:Dennd1a UTSW 2 37961654 missense probably damaging 1.00
R7109:Dennd1a UTSW 2 38048792 missense probably damaging 1.00
R7204:Dennd1a UTSW 2 38039203 missense probably damaging 1.00
R7235:Dennd1a UTSW 2 37801061 missense probably benign
Z1088:Dennd1a UTSW 2 37800692 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCTTTGACACTGTAAAGGGAC -3'
(R):5'- GCTTCCAGGTAGAAAGTGTGGGAC -3'

Sequencing Primer
(F):5'- AGGGACATGAATAATTAATGACGATG -3'
(R):5'- CAGGAAGAAGAGCACATGCC -3'
Posted On2013-10-16