Incidental Mutation 'R0785:Rps6kc1'
ID76804
Institutional Source Beutler Lab
Gene Symbol Rps6kc1
Ensembl Gene ENSMUSG00000089872
Gene Nameribosomal protein S6 kinase polypeptide 1
SynonymsRPK118
MMRRC Submission 038965-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0785 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location190700202-190911770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 190808945 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 387 (V387A)
Ref Sequence ENSEMBL: ENSMUSP00000061769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061611] [ENSMUST00000159367] [ENSMUST00000159624]
Predicted Effect probably damaging
Transcript: ENSMUST00000061611
AA Change: V387A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061769
Gene: ENSMUSG00000089872
AA Change: V387A

DomainStartEndE-ValueType
PX 9 128 1.26e-13 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
MIT 235 313 1.12e-20 SMART
low complexity region 317 332 N/A INTRINSIC
SCOP:d1apme_ 347 417 2e-5 SMART
low complexity region 443 454 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
Pfam:Pkinase 863 1046 4.4e-26 PFAM
Pfam:Pkinase_Tyr 876 1032 5.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159367
SMART Domains Protein: ENSMUSP00000124383
Gene: ENSMUSG00000089872

DomainStartEndE-ValueType
Blast:PX 9 50 4e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159624
SMART Domains Protein: ENSMUSP00000125010
Gene: ENSMUSG00000089872

DomainStartEndE-ValueType
PX 9 128 1.26e-13 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
Pfam:MIT 238 299 6.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159823
Predicted Effect probably benign
Transcript: ENSMUST00000160889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162500
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.1%
  • 20x: 87.1%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,334 probably benign Het
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Adam10 A G 9: 70,767,888 E593G possibly damaging Het
Adh6a T C 3: 138,329,068 probably benign Het
AI464131 A G 4: 41,497,539 V697A probably benign Het
Akap6 T A 12: 52,886,622 I299N probably benign Het
Bod1l A T 5: 41,820,016 N1318K probably benign Het
Cd3eap G C 7: 19,357,285 S299C probably benign Het
Eif2b2 C A 12: 85,221,561 T170K probably damaging Het
Ermard T A 17: 15,021,977 H138Q probably damaging Het
Ern2 A T 7: 122,171,661 probably null Het
Fkbp11 T C 15: 98,726,549 K108R probably damaging Het
Gm6588 A G 5: 112,450,568 D327G probably benign Het
Golgb1 A G 16: 36,898,790 K353E possibly damaging Het
Hipk1 G T 3: 103,754,325 probably null Het
Itga4 A G 2: 79,289,305 D485G possibly damaging Het
Krt2 C A 15: 101,817,921 G61C unknown Het
Med12l T A 3: 59,260,832 L1561Q probably damaging Het
Mtmr14 T C 6: 113,277,947 probably null Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Nav2 T A 7: 49,420,333 H251Q probably benign Het
Nphp4 A G 4: 152,562,109 D1366G possibly damaging Het
Olfr1535 A G 13: 21,555,788 V78A probably benign Het
Olfr790 A G 10: 129,500,881 probably null Het
Pde6c A C 19: 38,133,180 M79L probably benign Het
Pld5 C T 1: 175,975,452 probably benign Het
Tas2r136 T C 6: 132,777,927 D79G probably benign Het
Tmem243 A T 5: 9,118,488 K90I probably damaging Het
Topbp1 A G 9: 103,315,090 H260R probably damaging Het
Trappc1 A G 11: 69,324,810 probably benign Het
Vmn2r125 C A 4: 156,351,101 A258D probably benign Het
Zfp300 T C X: 21,082,925 Y200C possibly damaging Het
Other mutations in Rps6kc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rps6kc1 APN 1 190773678 missense probably damaging 1.00
IGL01310:Rps6kc1 APN 1 190783625 missense probably benign 0.45
IGL01331:Rps6kc1 APN 1 190800352 missense possibly damaging 0.49
IGL01551:Rps6kc1 APN 1 190773640 missense possibly damaging 0.70
IGL01665:Rps6kc1 APN 1 190911657 missense possibly damaging 0.66
IGL02178:Rps6kc1 APN 1 190871836 missense possibly damaging 0.63
IGL02550:Rps6kc1 APN 1 190871862 missense probably damaging 1.00
IGL02986:Rps6kc1 APN 1 190834061 missense probably damaging 1.00
IGL03010:Rps6kc1 APN 1 190911606 nonsense probably null
IGL03087:Rps6kc1 APN 1 190871711 missense probably damaging 1.00
IGL03130:Rps6kc1 APN 1 190799811 missense probably damaging 1.00
IGL03264:Rps6kc1 APN 1 190871829 missense probably benign
IGL03386:Rps6kc1 APN 1 190799570 missense probably damaging 0.97
R0184:Rps6kc1 UTSW 1 190799093 missense probably null 1.00
R0280:Rps6kc1 UTSW 1 190809000 missense probably damaging 1.00
R0482:Rps6kc1 UTSW 1 190799430 missense probably benign 0.00
R0651:Rps6kc1 UTSW 1 190799496 missense possibly damaging 0.51
R1398:Rps6kc1 UTSW 1 190800015 missense probably damaging 0.99
R1428:Rps6kc1 UTSW 1 190798726 missense probably damaging 1.00
R1484:Rps6kc1 UTSW 1 190799475 missense possibly damaging 0.63
R1536:Rps6kc1 UTSW 1 190871768 missense possibly damaging 0.89
R1709:Rps6kc1 UTSW 1 190800336 missense possibly damaging 0.72
R2060:Rps6kc1 UTSW 1 190810108 missense possibly damaging 0.94
R2153:Rps6kc1 UTSW 1 190798723 missense probably damaging 1.00
R2871:Rps6kc1 UTSW 1 190899569 missense probably damaging 1.00
R2871:Rps6kc1 UTSW 1 190899569 missense probably damaging 1.00
R4177:Rps6kc1 UTSW 1 190800419 missense possibly damaging 0.92
R4231:Rps6kc1 UTSW 1 190808900 missense probably damaging 1.00
R4401:Rps6kc1 UTSW 1 190799958 missense probably benign 0.32
R4402:Rps6kc1 UTSW 1 190798605 intron probably benign
R4785:Rps6kc1 UTSW 1 190750188 missense probably benign 0.00
R4810:Rps6kc1 UTSW 1 190808963 missense probably damaging 1.00
R4858:Rps6kc1 UTSW 1 190800318 missense probably damaging 1.00
R4887:Rps6kc1 UTSW 1 190798694 missense probably benign 0.13
R4976:Rps6kc1 UTSW 1 190798727 missense probably damaging 0.99
R5134:Rps6kc1 UTSW 1 190773648 missense probably damaging 1.00
R5217:Rps6kc1 UTSW 1 190783605 missense probably damaging 1.00
R5350:Rps6kc1 UTSW 1 190799466 missense probably benign
R5952:Rps6kc1 UTSW 1 190885420 missense probably benign 0.05
R5979:Rps6kc1 UTSW 1 190800435 missense probably damaging 1.00
R6597:Rps6kc1 UTSW 1 190750184 missense probably benign 0.20
R7024:Rps6kc1 UTSW 1 190800210 missense probably benign 0.00
R7192:Rps6kc1 UTSW 1 190800359 missense probably damaging 0.98
R7423:Rps6kc1 UTSW 1 190799096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATTGTCCCACAGGTCAGTGAG -3'
(R):5'- ACAGAGCAGCAGATGAGTGGTTTC -3'

Sequencing Primer
(F):5'- CCCACAGGTCAGTGAGTGATG -3'
(R):5'- CCCCGAGTAACTCGGATAGATTAG -3'
Posted On2013-10-16