Incidental Mutation 'R0785:Hipk1'
ID76808
Institutional Source Beutler Lab
Gene Symbol Hipk1
Ensembl Gene ENSMUSG00000008730
Gene Namehomeodomain interacting protein kinase 1
Synonyms1110062K04Rik, Myak
MMRRC Submission 038965-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0785 (G1)
Quality Score201
Status Validated
Chromosome3
Chromosomal Location103739815-103791563 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 103754325 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029438] [ENSMUST00000106845] [ENSMUST00000118317] [ENSMUST00000137078]
Predicted Effect probably null
Transcript: ENSMUST00000029438
SMART Domains Protein: ENSMUSP00000029438
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106845
SMART Domains Protein: ENSMUSP00000102458
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 1002 1018 N/A INTRINSIC
low complexity region 1050 1066 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118317
SMART Domains Protein: ENSMUSP00000113998
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121324
SMART Domains Protein: ENSMUSP00000114065
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 551 569 N/A INTRINSIC
low complexity region 645 661 N/A INTRINSIC
low complexity region 907 925 N/A INTRINSIC
low complexity region 1013 1029 N/A INTRINSIC
low complexity region 1061 1077 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135634
Predicted Effect probably benign
Transcript: ENSMUST00000137078
SMART Domains Protein: ENSMUSP00000120396
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 672 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200071
Meta Mutation Damage Score 0.6232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.1%
  • 20x: 87.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr family of protein kinases and HIPK subfamily. It phosphorylates homeodomain transcription factors and may also function as a co-repressor for homeodomain transcription factors. Alternative splicing results in four transcript variants encoding four distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile, do not develop spontaneous tumors, and are resistant to DMBA-induced skin tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,334 probably benign Het
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Adam10 A G 9: 70,767,888 E593G possibly damaging Het
Adh6a T C 3: 138,329,068 probably benign Het
AI464131 A G 4: 41,497,539 V697A probably benign Het
Akap6 T A 12: 52,886,622 I299N probably benign Het
Bod1l A T 5: 41,820,016 N1318K probably benign Het
Cd3eap G C 7: 19,357,285 S299C probably benign Het
Eif2b2 C A 12: 85,221,561 T170K probably damaging Het
Ermard T A 17: 15,021,977 H138Q probably damaging Het
Ern2 A T 7: 122,171,661 probably null Het
Fkbp11 T C 15: 98,726,549 K108R probably damaging Het
Gm6588 A G 5: 112,450,568 D327G probably benign Het
Golgb1 A G 16: 36,898,790 K353E possibly damaging Het
Itga4 A G 2: 79,289,305 D485G possibly damaging Het
Krt2 C A 15: 101,817,921 G61C unknown Het
Med12l T A 3: 59,260,832 L1561Q probably damaging Het
Mtmr14 T C 6: 113,277,947 probably null Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Nav2 T A 7: 49,420,333 H251Q probably benign Het
Nphp4 A G 4: 152,562,109 D1366G possibly damaging Het
Olfr1535 A G 13: 21,555,788 V78A probably benign Het
Olfr790 A G 10: 129,500,881 probably null Het
Pde6c A C 19: 38,133,180 M79L probably benign Het
Pld5 C T 1: 175,975,452 probably benign Het
Rps6kc1 A G 1: 190,808,945 V387A probably damaging Het
Tas2r136 T C 6: 132,777,927 D79G probably benign Het
Tmem243 A T 5: 9,118,488 K90I probably damaging Het
Topbp1 A G 9: 103,315,090 H260R probably damaging Het
Trappc1 A G 11: 69,324,810 probably benign Het
Vmn2r125 C A 4: 156,351,101 A258D probably benign Het
Zfp300 T C X: 21,082,925 Y200C possibly damaging Het
Other mutations in Hipk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Hipk1 APN 3 103778160 missense possibly damaging 0.49
IGL01024:Hipk1 APN 3 103760636 missense probably benign 0.31
IGL01069:Hipk1 APN 3 103777699 missense possibly damaging 0.95
IGL01798:Hipk1 APN 3 103761559 missense probably damaging 0.99
IGL01937:Hipk1 APN 3 103744004 missense possibly damaging 0.71
IGL01945:Hipk1 APN 3 103744004 missense possibly damaging 0.71
IGL02184:Hipk1 APN 3 103758750 missense possibly damaging 0.96
IGL02430:Hipk1 APN 3 103760655 missense probably damaging 1.00
IGL02603:Hipk1 APN 3 103750272 missense probably damaging 0.97
IGL02632:Hipk1 APN 3 103760545 missense probably benign 0.14
IGL02686:Hipk1 APN 3 103778017 missense possibly damaging 0.82
IGL03293:Hipk1 APN 3 103777259 missense possibly damaging 0.83
effluvient UTSW 3 103754325 splice site probably null
R0012:Hipk1 UTSW 3 103763680 missense probably damaging 0.98
R0012:Hipk1 UTSW 3 103763680 missense probably damaging 0.98
R0512:Hipk1 UTSW 3 103760574 missense possibly damaging 0.95
R0741:Hipk1 UTSW 3 103746812 missense probably benign 0.17
R0786:Hipk1 UTSW 3 103744304 missense probably benign
R0833:Hipk1 UTSW 3 103754296 missense probably damaging 0.98
R0836:Hipk1 UTSW 3 103754296 missense probably damaging 0.98
R1165:Hipk1 UTSW 3 103761524 missense possibly damaging 0.62
R1322:Hipk1 UTSW 3 103743981 missense probably damaging 1.00
R1384:Hipk1 UTSW 3 103758774 splice site probably benign
R1521:Hipk1 UTSW 3 103777782 missense probably benign 0.16
R1543:Hipk1 UTSW 3 103778164 missense probably benign 0.00
R2085:Hipk1 UTSW 3 103750354 missense probably benign 0.00
R2158:Hipk1 UTSW 3 103760538 missense probably damaging 1.00
R2291:Hipk1 UTSW 3 103761610 missense probably damaging 1.00
R3522:Hipk1 UTSW 3 103744114 missense probably damaging 0.96
R4516:Hipk1 UTSW 3 103750372 missense probably damaging 0.98
R4518:Hipk1 UTSW 3 103750372 missense probably damaging 0.98
R4884:Hipk1 UTSW 3 103744022 missense possibly damaging 0.47
R5023:Hipk1 UTSW 3 103777507 missense probably damaging 1.00
R6045:Hipk1 UTSW 3 103746902 missense probably benign 0.45
R6641:Hipk1 UTSW 3 103753405 missense probably damaging 0.99
R6904:Hipk1 UTSW 3 103777512 missense possibly damaging 0.90
R6925:Hipk1 UTSW 3 103778245 missense unknown
R7169:Hipk1 UTSW 3 103744217 missense probably benign
R7212:Hipk1 UTSW 3 103777610 nonsense probably null
R7313:Hipk1 UTSW 3 103778258 missense unknown
Z1088:Hipk1 UTSW 3 103764544 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATAGTGCTGCTCCGGCTTTTACCTG -3'
(R):5'- CCCATTCCCCTAGTGAACTGCAAG -3'

Sequencing Primer
(F):5'- TCCTCACAGGGAATCCAGAA -3'
(R):5'- AGAGTTTATATTCCCTTAAGCCAGCC -3'
Posted On2013-10-16