Incidental Mutation 'R0786:Tgm2'
ID76840
Institutional Source Beutler Lab
Gene Symbol Tgm2
Ensembl Gene ENSMUSG00000037820
Gene Nametransglutaminase 2, C polypeptide
SynonymstTG, protein-glutamine gamma-glutamyltransferase, TGase2, TG2, TG C, G[a]h, tTGas, tissue transglutaminase
MMRRC Submission 038966-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R0786 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location158116402-158146436 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 158124381 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 451 (E451G)
Ref Sequence ENSEMBL: ENSMUSP00000099411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103122] [ENSMUST00000152452] [ENSMUST00000174718]
Predicted Effect probably damaging
Transcript: ENSMUST00000103122
AA Change: E451G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099411
Gene: ENSMUSG00000037820
AA Change: E451G

DomainStartEndE-ValueType
Pfam:Transglut_N 6 122 3.6e-34 PFAM
TGc 269 361 1.11e-38 SMART
Pfam:Transglut_C 473 572 5.7e-29 PFAM
Pfam:Transglut_C 586 685 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152452
SMART Domains Protein: ENSMUSP00000118434
Gene: ENSMUSG00000027651

DomainStartEndE-ValueType
RPR 8 130 1.71e-53 SMART
low complexity region 132 145 N/A INTRINSIC
PDB:4FLA|D 171 222 3e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174718
SMART Domains Protein: ENSMUSP00000133662
Gene: ENSMUSG00000037820

DomainStartEndE-ValueType
Pfam:Transglut_N 5 124 1.9e-37 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene acts as a monomer, is induced by retinoic acid, and appears to be involved in apoptosis. Finally, the encoded protein is the autoantigen implicated in celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous null mutation causes alterations in glucose and aerobic energy metabolism, tumor growth, and response to myocardial infarction, liver injury, and LPS-induced sepsis. A second null mutation confers resistance to renal injury, while a third one alters cell adhesion and T cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 T C 8: 27,226,852 probably benign Het
Atg2b T C 12: 105,636,508 H1592R probably benign Het
Bpifb1 C T 2: 154,202,661 A16V probably benign Het
Casc1 A G 6: 145,181,757 probably null Het
Cep57 T A 9: 13,809,870 Y271F probably damaging Het
Cfap54 A T 10: 92,967,535 N1548K possibly damaging Het
Chrna6 A T 8: 27,408,380 D103E probably benign Het
Clec12b T C 6: 129,380,688 N69S probably benign Het
Col27a1 T C 4: 63,291,578 probably null Het
Cwh43 T A 5: 73,408,183 Y30* probably null Het
Dsg4 T C 18: 20,449,372 probably null Het
Efna3 T C 3: 89,316,573 N103S probably damaging Het
Efr3a A G 15: 65,853,551 D532G possibly damaging Het
Fam227a A T 15: 79,626,268 V395D probably benign Het
Fes T A 7: 80,386,920 D93V probably damaging Het
Gbp3 T A 3: 142,570,971 M510K possibly damaging Het
Gpr12 A T 5: 146,583,504 S44T probably damaging Het
Gpr179 T C 11: 97,343,274 N583S probably damaging Het
Hipk1 T C 3: 103,744,304 T1093A probably benign Het
Hspb1 T C 5: 135,889,243 L148P probably damaging Het
Kirrel3 A G 9: 35,034,865 N640S probably damaging Het
Mak G T 13: 41,046,069 Q365K probably benign Het
Melk A G 4: 44,303,649 Y14C unknown Het
Myh7 T C 14: 54,992,873 M1V probably null Het
Nsmf A G 2: 25,060,510 Y330C probably damaging Het
Parp14 A G 16: 35,840,802 F1592S possibly damaging Het
Pnpla6 A T 8: 3,523,317 I394F probably benign Het
Ppl T C 16: 5,089,054 R1126G probably damaging Het
Prss8 C T 7: 127,926,474 R291Q probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasgrp1 G T 2: 117,300,499 D155E probably benign Het
Recql5 T C 11: 115,895,802 I563V probably benign Het
Rhbg C T 3: 88,244,568 M394I probably benign Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Smg9 T C 7: 24,420,864 F421S probably benign Het
Tle1 T A 4: 72,199,361 T21S probably damaging Het
Tmc5 T C 7: 118,627,210 I266T possibly damaging Het
Tmigd3 T A 3: 105,917,002 C96S probably damaging Het
Trdn A T 10: 33,305,081 T361S probably benign Het
Vgll3 A T 16: 65,860,682 Q261L probably benign Het
Vmn2r104 A T 17: 20,042,725 I158K probably benign Het
Zfp964 A G 8: 69,664,081 K444E possibly damaging Het
Other mutations in Tgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Tgm2 APN 2 158124131 missense probably benign
IGL03110:Tgm2 APN 2 158131490 nonsense probably null
IGL03397:Tgm2 APN 2 158120258 missense probably damaging 1.00
R0595:Tgm2 UTSW 2 158143042 missense probably damaging 1.00
R1019:Tgm2 UTSW 2 158124154 nonsense probably null
R1395:Tgm2 UTSW 2 158124252 missense probably benign 0.01
R1732:Tgm2 UTSW 2 158134357 missense probably damaging 1.00
R1776:Tgm2 UTSW 2 158131459 missense probably benign 0.00
R1863:Tgm2 UTSW 2 158124219 missense probably damaging 1.00
R2863:Tgm2 UTSW 2 158143099 missense probably benign 0.01
R3036:Tgm2 UTSW 2 158124247 missense probably benign 0.00
R4200:Tgm2 UTSW 2 158132490 missense probably benign
R4370:Tgm2 UTSW 2 158124301 nonsense probably null
R4612:Tgm2 UTSW 2 158124204 missense probably benign 0.16
R5100:Tgm2 UTSW 2 158127164 missense probably benign 0.33
R5213:Tgm2 UTSW 2 158143060 missense possibly damaging 0.88
R5253:Tgm2 UTSW 2 158129438 missense probably damaging 1.00
R5585:Tgm2 UTSW 2 158131455 nonsense probably null
R5593:Tgm2 UTSW 2 158127342 missense probably damaging 1.00
R5616:Tgm2 UTSW 2 158128720 missense probably damaging 1.00
R5796:Tgm2 UTSW 2 158118904 missense probably benign 0.00
R5821:Tgm2 UTSW 2 158143054 missense possibly damaging 0.81
R5842:Tgm2 UTSW 2 158143081 missense probably damaging 1.00
R6317:Tgm2 UTSW 2 158124150 missense probably benign 0.18
R6610:Tgm2 UTSW 2 158143100 nonsense probably null
R7134:Tgm2 UTSW 2 158138892 missense probably benign
R7151:Tgm2 UTSW 2 158129395 missense possibly damaging 0.95
R7268:Tgm2 UTSW 2 158120268 nonsense probably null
X0058:Tgm2 UTSW 2 158124147 missense probably benign 0.01
X0067:Tgm2 UTSW 2 158118845 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGATGTCCTCAGTGCCACACTCG -3'
(R):5'- CCCGTACAAACGAATCATCGTGTCC -3'

Sequencing Primer
(F):5'- ACCCCGTTGTAGCTGACAG -3'
(R):5'- ATGGAACCTTGACTCTTGAGC -3'
Posted On2013-10-16