Incidental Mutation 'R0787:Fam217b'
ID76890
Institutional Source Beutler Lab
Gene Symbol Fam217b
Ensembl Gene ENSMUSG00000070476
Gene Namefamily with sequence similarity 217, member B
Synonyms
MMRRC Submission 038967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.024) question?
Stock #R0787 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location178414524-178424428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 178420909 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 222 (V222E)
Ref Sequence ENSEMBL: ENSMUSP00000091805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094251]
Predicted Effect probably benign
Transcript: ENSMUST00000094251
AA Change: V222E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000091805
Gene: ENSMUSG00000070476
AA Change: V222E

DomainStartEndE-ValueType
Pfam:FAM217 103 331 2.2e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129003
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T A 4: 107,890,129 L6Q probably damaging Het
1700001F09Rik A T 14: 43,345,493 probably null Het
Abca8a T A 11: 110,042,988 Y1197F possibly damaging Het
Abcc2 T C 19: 43,798,516 probably null Het
Adamts16 A T 13: 70,738,829 C979S probably damaging Het
Agap2 T A 10: 127,085,150 D523E unknown Het
Ankfy1 T A 11: 72,760,296 I1024N probably damaging Het
Ankrd13c A G 3: 157,994,678 S379G probably null Het
Arhgap40 T C 2: 158,547,790 S625P probably benign Het
Armc12 G C 17: 28,538,766 A291P probably damaging Het
Armc9 A G 1: 86,202,505 N524D probably damaging Het
Col12a1 G T 9: 79,638,485 T2305K probably damaging Het
Cyp2c54 T C 19: 40,047,635 N277S probably benign Het
E130311K13Rik A T 3: 63,920,298 V129E probably benign Het
Ehbp1l1 T C 19: 5,722,668 D79G possibly damaging Het
Epb41l1 A G 2: 156,494,090 E58G probably damaging Het
Fat1 T A 8: 45,040,555 Y3913N probably damaging Het
Fgd4 A G 16: 16,423,901 probably benign Het
Hltf A T 3: 20,106,446 D759V probably damaging Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Isg15 C T 4: 156,199,939 R44H probably benign Het
Itga4 C T 2: 79,279,153 T232I probably benign Het
Kntc1 C A 5: 123,796,104 H1399Q probably benign Het
Lig1 A C 7: 13,299,069 K499Q probably benign Het
Lrrn3 C A 12: 41,454,231 C29F probably damaging Het
Mtmr10 T C 7: 64,300,615 I136T possibly damaging Het
Naip1 A G 13: 100,426,096 Y854H probably benign Het
Olfr770 T C 10: 129,133,526 N81D possibly damaging Het
Pcdh9 G A 14: 93,886,757 A659V possibly damaging Het
Phf20l1 T A 15: 66,615,630 probably benign Het
Phgdh A G 3: 98,334,549 V83A probably damaging Het
Pik3r1 A T 13: 101,690,523 M326K probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd1l2 T C 8: 117,076,177 D235G possibly damaging Het
Pkhd1l1 C A 15: 44,529,264 P1665Q probably damaging Het
Ppp1r7 A G 1: 93,364,956 T326A probably damaging Het
Prr22 A T 17: 56,771,072 Y75F possibly damaging Het
Ptov1 A C 7: 44,865,470 probably null Het
Rasal2 A G 1: 157,158,696 S766P probably damaging Het
Shmt1 T C 11: 60,792,976 T337A probably benign Het
St5 G T 7: 109,525,620 R1068S possibly damaging Het
Tbc1d4 A T 14: 101,449,209 I1168N probably damaging Het
Tecpr2 T C 12: 110,946,343 V1126A probably benign Het
Tep1 A T 14: 50,829,230 S2304T possibly damaging Het
Tiam1 C A 16: 89,789,561 R1446M probably damaging Het
Tmem87a T C 2: 120,370,484 I425V probably benign Het
Ubr3 T C 2: 69,951,421 probably benign Het
Ubxn7 T A 16: 32,381,763 probably benign Het
Vmn2r13 A G 5: 109,156,847 S573P probably damaging Het
Wdfy3 A T 5: 101,957,388 V191E probably damaging Het
Zdhhc3 A T 9: 123,083,623 C153* probably null Het
Zfp407 A T 18: 84,209,022 V2154D probably damaging Het
Zfp407 A G 18: 84,209,346 V2046A probably benign Het
Zfr T A 15: 12,140,548 I227N unknown Het
Other mutations in Fam217b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fam217b APN 2 178421150 missense probably damaging 0.96
IGL01866:Fam217b APN 2 178420431 missense probably benign
IGL01974:Fam217b APN 2 178421227 missense probably damaging 1.00
IGL02376:Fam217b APN 2 178417573 missense probably benign
R0833:Fam217b UTSW 2 178420989 missense probably benign 0.00
R0836:Fam217b UTSW 2 178420989 missense probably benign 0.00
R1381:Fam217b UTSW 2 178420425 missense probably benign
R1903:Fam217b UTSW 2 178420581 missense probably benign 0.32
R5953:Fam217b UTSW 2 178420360 missense probably damaging 1.00
R6699:Fam217b UTSW 2 178420417 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCGTTCCCACGGAAGGAATACAG -3'
(R):5'- GCCCATCCACAGAGTTAGGCAAAG -3'

Sequencing Primer
(F):5'- GAAGCAAGCTGTTCCTTGAC -3'
(R):5'- AGTTAGGCAAAGTCTCAAATGC -3'
Posted On2013-10-16