Incidental Mutation 'R0787:Hltf'
ID76891
Institutional Source Beutler Lab
Gene Symbol Hltf
Ensembl Gene ENSMUSG00000002428
Gene Namehelicase-like transcription factor
SynonymsP113, Snf2l3, Smarca3
MMRRC Submission 038967-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0787 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location20057811-20118490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20106446 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 759 (D759V)
Ref Sequence ENSEMBL: ENSMUSP00000002502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]
Predicted Effect probably damaging
Transcript: ENSMUST00000002502
AA Change: D759V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428
AA Change: D759V

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 608 1.26e-32 SMART
RING 754 794 4.41e-6 SMART
low complexity region 814 828 N/A INTRINSIC
HELICc 859 944 2.24e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128127
Predicted Effect probably benign
Transcript: ENSMUST00000143005
SMART Domains Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 610 2.36e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145853
SMART Domains Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 1 92 2.7e-25 SMART
DEXDc 174 548 2.36e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155635
Meta Mutation Damage Score 0.374 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T A 4: 107,890,129 L6Q probably damaging Het
1700001F09Rik A T 14: 43,345,493 probably null Het
Abca8a T A 11: 110,042,988 Y1197F possibly damaging Het
Abcc2 T C 19: 43,798,516 probably null Het
Adamts16 A T 13: 70,738,829 C979S probably damaging Het
Agap2 T A 10: 127,085,150 D523E unknown Het
Ankfy1 T A 11: 72,760,296 I1024N probably damaging Het
Ankrd13c A G 3: 157,994,678 S379G probably null Het
Arhgap40 T C 2: 158,547,790 S625P probably benign Het
Armc12 G C 17: 28,538,766 A291P probably damaging Het
Armc9 A G 1: 86,202,505 N524D probably damaging Het
Col12a1 G T 9: 79,638,485 T2305K probably damaging Het
Cyp2c54 T C 19: 40,047,635 N277S probably benign Het
E130311K13Rik A T 3: 63,920,298 V129E probably benign Het
Ehbp1l1 T C 19: 5,722,668 D79G possibly damaging Het
Epb41l1 A G 2: 156,494,090 E58G probably damaging Het
Fam217b T A 2: 178,420,909 V222E probably benign Het
Fat1 T A 8: 45,040,555 Y3913N probably damaging Het
Fgd4 A G 16: 16,423,901 probably benign Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Isg15 C T 4: 156,199,939 R44H probably benign Het
Itga4 C T 2: 79,279,153 T232I probably benign Het
Kntc1 C A 5: 123,796,104 H1399Q probably benign Het
Lig1 A C 7: 13,299,069 K499Q probably benign Het
Lrrn3 C A 12: 41,454,231 C29F probably damaging Het
Mtmr10 T C 7: 64,300,615 I136T possibly damaging Het
Naip1 A G 13: 100,426,096 Y854H probably benign Het
Olfr770 T C 10: 129,133,526 N81D possibly damaging Het
Pcdh9 G A 14: 93,886,757 A659V possibly damaging Het
Phf20l1 T A 15: 66,615,630 probably benign Het
Phgdh A G 3: 98,334,549 V83A probably damaging Het
Pik3r1 A T 13: 101,690,523 M326K probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd1l2 T C 8: 117,076,177 D235G possibly damaging Het
Pkhd1l1 C A 15: 44,529,264 P1665Q probably damaging Het
Ppp1r7 A G 1: 93,364,956 T326A probably damaging Het
Prr22 A T 17: 56,771,072 Y75F possibly damaging Het
Ptov1 A C 7: 44,865,470 probably null Het
Rasal2 A G 1: 157,158,696 S766P probably damaging Het
Shmt1 T C 11: 60,792,976 T337A probably benign Het
St5 G T 7: 109,525,620 R1068S possibly damaging Het
Tbc1d4 A T 14: 101,449,209 I1168N probably damaging Het
Tecpr2 T C 12: 110,946,343 V1126A probably benign Het
Tep1 A T 14: 50,829,230 S2304T possibly damaging Het
Tiam1 C A 16: 89,789,561 R1446M probably damaging Het
Tmem87a T C 2: 120,370,484 I425V probably benign Het
Ubr3 T C 2: 69,951,421 probably benign Het
Ubxn7 T A 16: 32,381,763 probably benign Het
Vmn2r13 A G 5: 109,156,847 S573P probably damaging Het
Wdfy3 A T 5: 101,957,388 V191E probably damaging Het
Zdhhc3 A T 9: 123,083,623 C153* probably null Het
Zfp407 A T 18: 84,209,022 V2154D probably damaging Het
Zfp407 A G 18: 84,209,346 V2046A probably benign Het
Zfr T A 15: 12,140,548 I227N unknown Het
Other mutations in Hltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Hltf APN 3 20105632 splice site probably benign
IGL01461:Hltf APN 3 20099939 nonsense probably null
IGL01630:Hltf APN 3 20082904 splice site probably benign
IGL01704:Hltf APN 3 20083746 splice site probably benign
IGL02059:Hltf APN 3 20106457 missense probably benign
IGL02105:Hltf APN 3 20092757 missense probably damaging 1.00
IGL02156:Hltf APN 3 20092807 missense possibly damaging 0.61
IGL02870:Hltf APN 3 20099873 missense probably damaging 0.98
IGL02899:Hltf APN 3 20099817 missense probably damaging 1.00
IGL02935:Hltf APN 3 20069051 missense probably damaging 1.00
IGL02950:Hltf APN 3 20076572 missense probably benign 0.07
IGL03082:Hltf APN 3 20064559 splice site probably benign
R0068:Hltf UTSW 3 20059090 missense probably damaging 1.00
R0905:Hltf UTSW 3 20108869 critical splice donor site probably null
R0980:Hltf UTSW 3 20091501 missense probably benign 0.00
R1741:Hltf UTSW 3 20086188 missense probably damaging 1.00
R1748:Hltf UTSW 3 20076521 missense probably benign 0.13
R1799:Hltf UTSW 3 20105691 missense probably damaging 1.00
R1976:Hltf UTSW 3 20106446 missense probably damaging 1.00
R2171:Hltf UTSW 3 20059081 missense probably damaging 1.00
R2395:Hltf UTSW 3 20092742 missense probably benign 0.41
R2444:Hltf UTSW 3 20063907 missense possibly damaging 0.66
R3789:Hltf UTSW 3 20069047 missense probably damaging 1.00
R3943:Hltf UTSW 3 20092744 missense probably damaging 1.00
R4719:Hltf UTSW 3 20064701 critical splice donor site probably null
R4793:Hltf UTSW 3 20063950 missense possibly damaging 0.79
R5296:Hltf UTSW 3 20108112 missense probably damaging 0.99
R5449:Hltf UTSW 3 20069083 missense possibly damaging 0.92
R5492:Hltf UTSW 3 20098067 splice site probably null
R6012:Hltf UTSW 3 20058934 missense probably damaging 1.00
R6157:Hltf UTSW 3 20076496 missense probably benign 0.13
R6254:Hltf UTSW 3 20063829 missense possibly damaging 0.85
R6553:Hltf UTSW 3 20072394 missense probably damaging 0.96
R6616:Hltf UTSW 3 20109487 critical splice donor site probably null
R6696:Hltf UTSW 3 20065306 intron probably null
R6761:Hltf UTSW 3 20083832 critical splice donor site probably null
R6781:Hltf UTSW 3 20098166 missense probably benign 0.00
X0027:Hltf UTSW 3 20067389 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTGTATGCTGCTAGTGTGGCAGAT -3'
(R):5'- TCTCTGGAACGTGGCTGGGT -3'

Sequencing Primer
(F):5'- GGCATGATTTCTGCAAATACCAG -3'
(R):5'- TGGCTGGGTTTTTATTATACCAAAG -3'
Posted On2013-10-16