Incidental Mutation 'R0787:Vmn2r13'
ID76898
Institutional Source Beutler Lab
Gene Symbol Vmn2r13
Ensembl Gene ENSMUSG00000091635
Gene Namevomeronasal 2, receptor 13
SynonymsGm4867
MMRRC Submission 038967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R0787 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location109156068-109192107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109156847 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 573 (S573P)
Ref Sequence ENSEMBL: ENSMUSP00000052977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053253]
Predicted Effect probably damaging
Transcript: ENSMUST00000053253
AA Change: S573P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052977
Gene: ENSMUSG00000091635
AA Change: S573P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 76 463 2.8e-29 PFAM
Pfam:NCD3G 506 560 1.3e-18 PFAM
Pfam:7tm_3 593 828 1.8e-54 PFAM
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T A 4: 107,890,129 L6Q probably damaging Het
1700001F09Rik A T 14: 43,345,493 probably null Het
Abca8a T A 11: 110,042,988 Y1197F possibly damaging Het
Abcc2 T C 19: 43,798,516 probably null Het
Adamts16 A T 13: 70,738,829 C979S probably damaging Het
Agap2 T A 10: 127,085,150 D523E unknown Het
Ankfy1 T A 11: 72,760,296 I1024N probably damaging Het
Ankrd13c A G 3: 157,994,678 S379G probably null Het
Arhgap40 T C 2: 158,547,790 S625P probably benign Het
Armc12 G C 17: 28,538,766 A291P probably damaging Het
Armc9 A G 1: 86,202,505 N524D probably damaging Het
Col12a1 G T 9: 79,638,485 T2305K probably damaging Het
Cyp2c54 T C 19: 40,047,635 N277S probably benign Het
E130311K13Rik A T 3: 63,920,298 V129E probably benign Het
Ehbp1l1 T C 19: 5,722,668 D79G possibly damaging Het
Epb41l1 A G 2: 156,494,090 E58G probably damaging Het
Fam217b T A 2: 178,420,909 V222E probably benign Het
Fat1 T A 8: 45,040,555 Y3913N probably damaging Het
Fgd4 A G 16: 16,423,901 probably benign Het
Hltf A T 3: 20,106,446 D759V probably damaging Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Isg15 C T 4: 156,199,939 R44H probably benign Het
Itga4 C T 2: 79,279,153 T232I probably benign Het
Kntc1 C A 5: 123,796,104 H1399Q probably benign Het
Lig1 A C 7: 13,299,069 K499Q probably benign Het
Lrrn3 C A 12: 41,454,231 C29F probably damaging Het
Mtmr10 T C 7: 64,300,615 I136T possibly damaging Het
Naip1 A G 13: 100,426,096 Y854H probably benign Het
Olfr770 T C 10: 129,133,526 N81D possibly damaging Het
Pcdh9 G A 14: 93,886,757 A659V possibly damaging Het
Phf20l1 T A 15: 66,615,630 probably benign Het
Phgdh A G 3: 98,334,549 V83A probably damaging Het
Pik3r1 A T 13: 101,690,523 M326K probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd1l2 T C 8: 117,076,177 D235G possibly damaging Het
Pkhd1l1 C A 15: 44,529,264 P1665Q probably damaging Het
Ppp1r7 A G 1: 93,364,956 T326A probably damaging Het
Prr22 A T 17: 56,771,072 Y75F possibly damaging Het
Ptov1 A C 7: 44,865,470 probably null Het
Rasal2 A G 1: 157,158,696 S766P probably damaging Het
Shmt1 T C 11: 60,792,976 T337A probably benign Het
St5 G T 7: 109,525,620 R1068S possibly damaging Het
Tbc1d4 A T 14: 101,449,209 I1168N probably damaging Het
Tecpr2 T C 12: 110,946,343 V1126A probably benign Het
Tep1 A T 14: 50,829,230 S2304T possibly damaging Het
Tiam1 C A 16: 89,789,561 R1446M probably damaging Het
Tmem87a T C 2: 120,370,484 I425V probably benign Het
Ubr3 T C 2: 69,951,421 probably benign Het
Ubxn7 T A 16: 32,381,763 probably benign Het
Wdfy3 A T 5: 101,957,388 V191E probably damaging Het
Zdhhc3 A T 9: 123,083,623 C153* probably null Het
Zfp407 A T 18: 84,209,022 V2154D probably damaging Het
Zfp407 A G 18: 84,209,346 V2046A probably benign Het
Zfr T A 15: 12,140,548 I227N unknown Het
Other mutations in Vmn2r13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Vmn2r13 APN 5 109156098 missense probably damaging 1.00
IGL01373:Vmn2r13 APN 5 109156702 missense probably damaging 1.00
IGL01946:Vmn2r13 APN 5 109174219 missense probably benign 0.01
IGL01971:Vmn2r13 APN 5 109174115 missense probably benign 0.01
IGL02636:Vmn2r13 APN 5 109192017 missense probably damaging 0.98
IGL03062:Vmn2r13 APN 5 109156282 missense probably damaging 1.00
IGL03173:Vmn2r13 APN 5 109171779 missense possibly damaging 0.95
IGL03301:Vmn2r13 APN 5 109158089 missense probably damaging 0.99
IGL03383:Vmn2r13 APN 5 109156532 missense probably damaging 0.98
IGL03048:Vmn2r13 UTSW 5 109156285 missense probably damaging 1.00
R0123:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0134:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0220:Vmn2r13 UTSW 5 109156466 missense probably damaging 1.00
R0225:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0393:Vmn2r13 UTSW 5 109156529 missense probably benign 0.01
R0410:Vmn2r13 UTSW 5 109173813 missense probably benign 0.35
R1200:Vmn2r13 UTSW 5 109174202 missense probably damaging 1.00
R1448:Vmn2r13 UTSW 5 109174135 missense probably damaging 1.00
R1782:Vmn2r13 UTSW 5 109158174 missense probably benign 0.08
R1939:Vmn2r13 UTSW 5 109191986 missense possibly damaging 0.88
R2029:Vmn2r13 UTSW 5 109192077 missense probably benign 0.13
R2125:Vmn2r13 UTSW 5 109158192 missense probably benign 0.00
R2126:Vmn2r13 UTSW 5 109158192 missense probably benign 0.00
R2379:Vmn2r13 UTSW 5 109171778 missense probably benign 0.05
R2680:Vmn2r13 UTSW 5 109174312 missense possibly damaging 0.66
R2888:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R2889:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R2890:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R3014:Vmn2r13 UTSW 5 109171761 missense possibly damaging 0.81
R3683:Vmn2r13 UTSW 5 109156855 missense probably damaging 1.00
R4074:Vmn2r13 UTSW 5 109156700 missense probably damaging 1.00
R4599:Vmn2r13 UTSW 5 109156456 missense probably damaging 1.00
R4614:Vmn2r13 UTSW 5 109175199 missense probably benign 0.01
R4805:Vmn2r13 UTSW 5 109156465 missense probably damaging 1.00
R4822:Vmn2r13 UTSW 5 109174072 missense probably damaging 0.99
R4943:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R5263:Vmn2r13 UTSW 5 109173975 missense probably benign 0.00
R5297:Vmn2r13 UTSW 5 109191939 missense probably benign 0.00
R5502:Vmn2r13 UTSW 5 109173714 missense probably damaging 1.00
R5554:Vmn2r13 UTSW 5 109191994 missense possibly damaging 0.49
R5563:Vmn2r13 UTSW 5 109173980 missense probably benign 0.00
R5819:Vmn2r13 UTSW 5 109174100 missense possibly damaging 0.79
R6074:Vmn2r13 UTSW 5 109174301 missense probably benign 0.04
R6416:Vmn2r13 UTSW 5 109174116 missense probably damaging 0.99
R6419:Vmn2r13 UTSW 5 109175219 missense possibly damaging 0.87
R6484:Vmn2r13 UTSW 5 109156674 nonsense probably null
R6486:Vmn2r13 UTSW 5 109156559 missense probably benign 0.05
R6545:Vmn2r13 UTSW 5 109156940 splice site probably null
R6700:Vmn2r13 UTSW 5 109175072 missense probably benign 0.00
R6897:Vmn2r13 UTSW 5 109158149 missense possibly damaging 0.90
R6957:Vmn2r13 UTSW 5 109156887 nonsense probably null
X0066:Vmn2r13 UTSW 5 109156219 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TCATCCTTCTCCCTGGAGTAGTGAGC -3'
(R):5'- TGGCATCAGTAACTATGTCTGCACAC -3'

Sequencing Primer
(F):5'- CACTGTAGAAATAGCCACTGTG -3'
(R):5'- GCACACTACACTTGTCTGTGAG -3'
Posted On2013-10-16