Incidental Mutation 'R0787:Lig1'
ID76901
Institutional Source Beutler Lab
Gene Symbol Lig1
Ensembl Gene ENSMUSG00000056394
Gene Nameligase I, DNA, ATP-dependent
SynonymsLigI, mLigI
MMRRC Submission 038967-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0787 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location13277283-13311433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 13299069 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 499 (K499Q)
Ref Sequence ENSEMBL: ENSMUSP00000136972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098814] [ENSMUST00000165964] [ENSMUST00000177588]
Predicted Effect probably benign
Transcript: ENSMUST00000098814
AA Change: K499Q

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096411
Gene: ENSMUSG00000056394
AA Change: K499Q

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123846
SMART Domains Protein: ENSMUSP00000119788
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147735
SMART Domains Protein: ENSMUSP00000115286
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148471
SMART Domains Protein: ENSMUSP00000114153
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156525
SMART Domains Protein: ENSMUSP00000118055
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165964
AA Change: K499Q

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126525
Gene: ENSMUSG00000056394
AA Change: K499Q

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 302 478 1.7e-40 PFAM
Pfam:DNA_ligase_A_M 556 760 1.1e-69 PFAM
Pfam:DNA_ligase_A_C 785 896 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177588
AA Change: K499Q

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136972
Gene: ENSMUSG00000056394
AA Change: K499Q

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-dependent DNA ligase protein family. The encoded protein functions in DNA replication, recombination, and the base excision repair process. Mutations in this gene that lead to DNA ligase I deficiency result in immunodeficiency and increased sensitivity to DNA-damaging agents. Disruption of this gene may also be associated with a variety of cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired fetal hematopoiesis, develop anemia, and die by E16.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T A 4: 107,890,129 L6Q probably damaging Het
1700001F09Rik A T 14: 43,345,493 probably null Het
Abca8a T A 11: 110,042,988 Y1197F possibly damaging Het
Abcc2 T C 19: 43,798,516 probably null Het
Adamts16 A T 13: 70,738,829 C979S probably damaging Het
Agap2 T A 10: 127,085,150 D523E unknown Het
Ankfy1 T A 11: 72,760,296 I1024N probably damaging Het
Ankrd13c A G 3: 157,994,678 S379G probably null Het
Arhgap40 T C 2: 158,547,790 S625P probably benign Het
Armc12 G C 17: 28,538,766 A291P probably damaging Het
Armc9 A G 1: 86,202,505 N524D probably damaging Het
Col12a1 G T 9: 79,638,485 T2305K probably damaging Het
Cyp2c54 T C 19: 40,047,635 N277S probably benign Het
E130311K13Rik A T 3: 63,920,298 V129E probably benign Het
Ehbp1l1 T C 19: 5,722,668 D79G possibly damaging Het
Epb41l1 A G 2: 156,494,090 E58G probably damaging Het
Fam217b T A 2: 178,420,909 V222E probably benign Het
Fat1 T A 8: 45,040,555 Y3913N probably damaging Het
Fgd4 A G 16: 16,423,901 probably benign Het
Hltf A T 3: 20,106,446 D759V probably damaging Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Isg15 C T 4: 156,199,939 R44H probably benign Het
Itga4 C T 2: 79,279,153 T232I probably benign Het
Kntc1 C A 5: 123,796,104 H1399Q probably benign Het
Lrrn3 C A 12: 41,454,231 C29F probably damaging Het
Mtmr10 T C 7: 64,300,615 I136T possibly damaging Het
Naip1 A G 13: 100,426,096 Y854H probably benign Het
Olfr770 T C 10: 129,133,526 N81D possibly damaging Het
Pcdh9 G A 14: 93,886,757 A659V possibly damaging Het
Phf20l1 T A 15: 66,615,630 probably benign Het
Phgdh A G 3: 98,334,549 V83A probably damaging Het
Pik3r1 A T 13: 101,690,523 M326K probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd1l2 T C 8: 117,076,177 D235G possibly damaging Het
Pkhd1l1 C A 15: 44,529,264 P1665Q probably damaging Het
Ppp1r7 A G 1: 93,364,956 T326A probably damaging Het
Prr22 A T 17: 56,771,072 Y75F possibly damaging Het
Ptov1 A C 7: 44,865,470 probably null Het
Rasal2 A G 1: 157,158,696 S766P probably damaging Het
Shmt1 T C 11: 60,792,976 T337A probably benign Het
St5 G T 7: 109,525,620 R1068S possibly damaging Het
Tbc1d4 A T 14: 101,449,209 I1168N probably damaging Het
Tecpr2 T C 12: 110,946,343 V1126A probably benign Het
Tep1 A T 14: 50,829,230 S2304T possibly damaging Het
Tiam1 C A 16: 89,789,561 R1446M probably damaging Het
Tmem87a T C 2: 120,370,484 I425V probably benign Het
Ubr3 T C 2: 69,951,421 probably benign Het
Ubxn7 T A 16: 32,381,763 probably benign Het
Vmn2r13 A G 5: 109,156,847 S573P probably damaging Het
Wdfy3 A T 5: 101,957,388 V191E probably damaging Het
Zdhhc3 A T 9: 123,083,623 C153* probably null Het
Zfp407 A T 18: 84,209,022 V2154D probably damaging Het
Zfp407 A G 18: 84,209,346 V2046A probably benign Het
Zfr T A 15: 12,140,548 I227N unknown Het
Other mutations in Lig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Lig1 APN 7 13301452 nonsense probably null
IGL00499:Lig1 APN 7 13298830 critical splice donor site probably null
IGL01465:Lig1 APN 7 13296391 missense probably benign 0.19
IGL01804:Lig1 APN 7 13309206 missense probably benign 0.43
IGL02068:Lig1 APN 7 13292451 splice site probably benign
IGL02955:Lig1 APN 7 13296347 missense probably damaging 0.99
IGL03188:Lig1 APN 7 13311107 splice site probably benign
IGL03327:Lig1 APN 7 13303855 missense probably damaging 1.00
IGL03411:Lig1 APN 7 13296768 missense probably damaging 1.00
PIT4142001:Lig1 UTSW 7 13305924 frame shift probably null
R0085:Lig1 UTSW 7 13307570 missense possibly damaging 0.66
R0348:Lig1 UTSW 7 13309197 missense probably damaging 1.00
R0362:Lig1 UTSW 7 13296804 unclassified probably benign
R1170:Lig1 UTSW 7 13292153 missense probably benign 0.00
R1371:Lig1 UTSW 7 13288685 missense probably damaging 1.00
R1610:Lig1 UTSW 7 13285340 missense probably damaging 1.00
R1809:Lig1 UTSW 7 13300355 splice site probably benign
R1986:Lig1 UTSW 7 13309142 nonsense probably null
R2106:Lig1 UTSW 7 13305938 missense probably damaging 1.00
R2343:Lig1 UTSW 7 13292195 unclassified probably null
R2380:Lig1 UTSW 7 13303796 splice site probably benign
R3545:Lig1 UTSW 7 13292163 missense possibly damaging 0.82
R4669:Lig1 UTSW 7 13311028 missense probably damaging 1.00
R4928:Lig1 UTSW 7 13298738 missense probably damaging 1.00
R5167:Lig1 UTSW 7 13311058 missense probably damaging 0.97
R5249:Lig1 UTSW 7 13308507 missense possibly damaging 0.60
R5351:Lig1 UTSW 7 13300949 missense probably damaging 1.00
R5373:Lig1 UTSW 7 13305923 frame shift probably null
R5607:Lig1 UTSW 7 13306008 missense probably damaging 0.97
R5608:Lig1 UTSW 7 13306008 missense probably damaging 0.97
R5620:Lig1 UTSW 7 13286606 missense possibly damaging 0.66
R5799:Lig1 UTSW 7 13296258 missense possibly damaging 0.67
R6057:Lig1 UTSW 7 13288672 missense probably damaging 0.99
R6897:Lig1 UTSW 7 13305914 missense probably damaging 1.00
X0020:Lig1 UTSW 7 13296774 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AGAATGCACTTGGGCAGCCTAC -3'
(R):5'- AAGCCCTAATCCTCTCTGTGCTGG -3'

Sequencing Primer
(F):5'- GGGCAGCCTACCTCATTC -3'
(R):5'- ATTATGAGTAGTCACCAGCCTC -3'
Posted On2013-10-16