Incidental Mutation 'R0787:Ptov1'
ID76902
Institutional Source Beutler Lab
Gene Symbol Ptov1
Ensembl Gene ENSMUSG00000038502
Gene Nameprostate tumor over expressed gene 1
SynonymsGcap3, 1110030G05Rik
MMRRC Submission 038967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R0787 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44863067-44869788 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 44865470 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000003044] [ENSMUST00000046575] [ENSMUST00000098478] [ENSMUST00000107876] [ENSMUST00000123015] [ENSMUST00000124168] [ENSMUST00000155050] [ENSMUST00000200892] [ENSMUST00000201882] [ENSMUST00000202646] [ENSMUST00000207363] [ENSMUST00000209018]
Predicted Effect probably benign
Transcript: ENSMUST00000003044
SMART Domains Protein: ENSMUSP00000003044
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.3e-58 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 1.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000046575
SMART Domains Protein: ENSMUSP00000035281
Gene: ENSMUSG00000038502

DomainStartEndE-ValueType
low complexity region 10 50 N/A INTRINSIC
low complexity region 64 82 N/A INTRINSIC
Pfam:Med25 89 238 1.7e-58 PFAM
Pfam:Med25 254 399 4.2e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098478
SMART Domains Protein: ENSMUSP00000096078
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 2e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 220 2.9e-16 PFAM
Pfam:PNK3P 211 291 5.3e-27 PFAM
low complexity region 314 328 N/A INTRINSIC
Pfam:AAA_33 330 452 5.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107876
SMART Domains Protein: ENSMUSP00000103508
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 1.9e-57 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 5.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123015
SMART Domains Protein: ENSMUSP00000143862
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJ5|C 1 143 8e-72 PDB
SCOP:d1lgpa_ 8 114 7e-13 SMART
Blast:FHA 31 74 2e-10 BLAST
PDB:3U7G|A 144 165 7e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000124168
SMART Domains Protein: ENSMUSP00000144330
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 51 3e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152747
Predicted Effect probably benign
Transcript: ENSMUST00000155050
SMART Domains Protein: ENSMUSP00000144663
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 50 9e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000200892
SMART Domains Protein: ENSMUSP00000144163
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
Pfam:AAA_33 18 100 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201882
SMART Domains Protein: ENSMUSP00000144690
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 6e-63 PDB
SCOP:d1lgpa_ 8 114 3e-12 SMART
Blast:FHA 31 74 2e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.9e-55 PFAM
low complexity region 350 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202646
SMART Domains Protein: ENSMUSP00000144484
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
Pfam:AAA_33 5 44 6.1e-7 PFAM
Pfam:AAA_33 37 117 4.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207303
Predicted Effect probably benign
Transcript: ENSMUST00000207363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207393
Predicted Effect probably benign
Transcript: ENSMUST00000207416
Predicted Effect probably benign
Transcript: ENSMUST00000208385
Predicted Effect probably benign
Transcript: ENSMUST00000208410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208655
Predicted Effect probably benign
Transcript: ENSMUST00000208666
Predicted Effect probably null
Transcript: ENSMUST00000208682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209003
Predicted Effect probably benign
Transcript: ENSMUST00000209018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209139
Meta Mutation Damage Score 0.584 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was found to be overexpressed in prostate adenocarcinomas. The encoded protein was found to interact with the lipid raft protein flotillin-1 and shuttle it from the cytoplasm to the nucleus in a cell cycle dependent manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T A 4: 107,890,129 L6Q probably damaging Het
1700001F09Rik A T 14: 43,345,493 probably null Het
Abca8a T A 11: 110,042,988 Y1197F possibly damaging Het
Abcc2 T C 19: 43,798,516 probably null Het
Adamts16 A T 13: 70,738,829 C979S probably damaging Het
Agap2 T A 10: 127,085,150 D523E unknown Het
Ankfy1 T A 11: 72,760,296 I1024N probably damaging Het
Ankrd13c A G 3: 157,994,678 S379G probably null Het
Arhgap40 T C 2: 158,547,790 S625P probably benign Het
Armc12 G C 17: 28,538,766 A291P probably damaging Het
Armc9 A G 1: 86,202,505 N524D probably damaging Het
Col12a1 G T 9: 79,638,485 T2305K probably damaging Het
Cyp2c54 T C 19: 40,047,635 N277S probably benign Het
E130311K13Rik A T 3: 63,920,298 V129E probably benign Het
Ehbp1l1 T C 19: 5,722,668 D79G possibly damaging Het
Epb41l1 A G 2: 156,494,090 E58G probably damaging Het
Fam217b T A 2: 178,420,909 V222E probably benign Het
Fat1 T A 8: 45,040,555 Y3913N probably damaging Het
Fgd4 A G 16: 16,423,901 probably benign Het
Hltf A T 3: 20,106,446 D759V probably damaging Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Isg15 C T 4: 156,199,939 R44H probably benign Het
Itga4 C T 2: 79,279,153 T232I probably benign Het
Kntc1 C A 5: 123,796,104 H1399Q probably benign Het
Lig1 A C 7: 13,299,069 K499Q probably benign Het
Lrrn3 C A 12: 41,454,231 C29F probably damaging Het
Mtmr10 T C 7: 64,300,615 I136T possibly damaging Het
Naip1 A G 13: 100,426,096 Y854H probably benign Het
Olfr770 T C 10: 129,133,526 N81D possibly damaging Het
Pcdh9 G A 14: 93,886,757 A659V possibly damaging Het
Phf20l1 T A 15: 66,615,630 probably benign Het
Phgdh A G 3: 98,334,549 V83A probably damaging Het
Pik3r1 A T 13: 101,690,523 M326K probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd1l2 T C 8: 117,076,177 D235G possibly damaging Het
Pkhd1l1 C A 15: 44,529,264 P1665Q probably damaging Het
Ppp1r7 A G 1: 93,364,956 T326A probably damaging Het
Prr22 A T 17: 56,771,072 Y75F possibly damaging Het
Rasal2 A G 1: 157,158,696 S766P probably damaging Het
Shmt1 T C 11: 60,792,976 T337A probably benign Het
St5 G T 7: 109,525,620 R1068S possibly damaging Het
Tbc1d4 A T 14: 101,449,209 I1168N probably damaging Het
Tecpr2 T C 12: 110,946,343 V1126A probably benign Het
Tep1 A T 14: 50,829,230 S2304T possibly damaging Het
Tiam1 C A 16: 89,789,561 R1446M probably damaging Het
Tmem87a T C 2: 120,370,484 I425V probably benign Het
Ubr3 T C 2: 69,951,421 probably benign Het
Ubxn7 T A 16: 32,381,763 probably benign Het
Vmn2r13 A G 5: 109,156,847 S573P probably damaging Het
Wdfy3 A T 5: 101,957,388 V191E probably damaging Het
Zdhhc3 A T 9: 123,083,623 C153* probably null Het
Zfp407 A T 18: 84,209,022 V2154D probably damaging Het
Zfp407 A G 18: 84,209,346 V2046A probably benign Het
Zfr T A 15: 12,140,548 I227N unknown Het
Other mutations in Ptov1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01644:Ptov1 APN 7 44867502 nonsense probably null
IGL02217:Ptov1 APN 7 44867476 missense probably damaging 1.00
R0304:Ptov1 UTSW 7 44863449 splice site probably null
R0335:Ptov1 UTSW 7 44864622 missense possibly damaging 0.80
R0470:Ptov1 UTSW 7 44864811 missense probably damaging 0.96
R1844:Ptov1 UTSW 7 44865567 missense possibly damaging 0.95
R2185:Ptov1 UTSW 7 44867283 unclassified probably benign
R3005:Ptov1 UTSW 7 44864462 missense probably damaging 0.99
R4460:Ptov1 UTSW 7 44865576 missense probably benign 0.01
R4731:Ptov1 UTSW 7 44867109 missense probably benign 0.23
R4732:Ptov1 UTSW 7 44867109 missense probably benign 0.23
R4733:Ptov1 UTSW 7 44867109 missense probably benign 0.23
R5063:Ptov1 UTSW 7 44865602 missense possibly damaging 0.52
R5356:Ptov1 UTSW 7 44864665 missense probably damaging 0.97
R5391:Ptov1 UTSW 7 44863584 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGCCCCTCTGAAGCCTATAAAGC -3'
(R):5'- TCCCCAGGCAGTAAGATGTTGAGTG -3'

Sequencing Primer
(F):5'- CTGAAGCCTATAAAGCTATGTTTCCC -3'
(R):5'- TGAGTGTGGAGGCCCAG -3'
Posted On2013-10-16