Incidental Mutation 'R0787:Agap2'
ID76909
Institutional Source Beutler Lab
Gene Symbol Agap2
Ensembl Gene ENSMUSG00000025422
Gene NameArfGAP with GTPase domain, ankyrin repeat and PH domain 2
SynonymsCentg1
MMRRC Submission 038967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R0787 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127075284-127093169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127085150 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 523 (D523E)
Ref Sequence ENSEMBL: ENSMUSP00000151946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039259] [ENSMUST00000217941]
Predicted Effect unknown
Transcript: ENSMUST00000039259
AA Change: D523E
SMART Domains Protein: ENSMUSP00000043466
Gene: ENSMUSG00000025422
AA Change: D523E

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 137 149 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
low complexity region 222 257 N/A INTRINSIC
low complexity region 306 322 N/A INTRINSIC
low complexity region 349 376 N/A INTRINSIC
Pfam:Ras 402 562 3.6e-16 PFAM
low complexity region 575 590 N/A INTRINSIC
low complexity region 600 609 N/A INTRINSIC
PH 671 906 4.35e-14 SMART
ArfGap 925 1045 8.8e-62 SMART
low complexity region 1052 1071 N/A INTRINSIC
ANK 1084 1113 1.15e0 SMART
ANK 1117 1145 3.69e2 SMART
low complexity region 1148 1175 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217941
AA Change: D523E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218292
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the centaurin GTPase family. This gene product regulates the activity of multiple kinases, including PI3K. Reduced expression of this gene results in multiple defects, including neural deficiencies, while increased expression of this gene has been observed in some tumors. Alternative splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lactation due to abnormal mammary gland growth during lactation, failure of insulin-suppressed gluconeogenesis, and hyperglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T A 4: 107,890,129 L6Q probably damaging Het
1700001F09Rik A T 14: 43,345,493 probably null Het
Abca8a T A 11: 110,042,988 Y1197F possibly damaging Het
Abcc2 T C 19: 43,798,516 probably null Het
Adamts16 A T 13: 70,738,829 C979S probably damaging Het
Ankfy1 T A 11: 72,760,296 I1024N probably damaging Het
Ankrd13c A G 3: 157,994,678 S379G probably null Het
Arhgap40 T C 2: 158,547,790 S625P probably benign Het
Armc12 G C 17: 28,538,766 A291P probably damaging Het
Armc9 A G 1: 86,202,505 N524D probably damaging Het
Col12a1 G T 9: 79,638,485 T2305K probably damaging Het
Cyp2c54 T C 19: 40,047,635 N277S probably benign Het
E130311K13Rik A T 3: 63,920,298 V129E probably benign Het
Ehbp1l1 T C 19: 5,722,668 D79G possibly damaging Het
Epb41l1 A G 2: 156,494,090 E58G probably damaging Het
Fam217b T A 2: 178,420,909 V222E probably benign Het
Fat1 T A 8: 45,040,555 Y3913N probably damaging Het
Fgd4 A G 16: 16,423,901 probably benign Het
Hltf A T 3: 20,106,446 D759V probably damaging Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Isg15 C T 4: 156,199,939 R44H probably benign Het
Itga4 C T 2: 79,279,153 T232I probably benign Het
Kntc1 C A 5: 123,796,104 H1399Q probably benign Het
Lig1 A C 7: 13,299,069 K499Q probably benign Het
Lrrn3 C A 12: 41,454,231 C29F probably damaging Het
Mtmr10 T C 7: 64,300,615 I136T possibly damaging Het
Naip1 A G 13: 100,426,096 Y854H probably benign Het
Olfr770 T C 10: 129,133,526 N81D possibly damaging Het
Pcdh9 G A 14: 93,886,757 A659V possibly damaging Het
Phf20l1 T A 15: 66,615,630 probably benign Het
Phgdh A G 3: 98,334,549 V83A probably damaging Het
Pik3r1 A T 13: 101,690,523 M326K probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd1l2 T C 8: 117,076,177 D235G possibly damaging Het
Pkhd1l1 C A 15: 44,529,264 P1665Q probably damaging Het
Ppp1r7 A G 1: 93,364,956 T326A probably damaging Het
Prr22 A T 17: 56,771,072 Y75F possibly damaging Het
Ptov1 A C 7: 44,865,470 probably null Het
Rasal2 A G 1: 157,158,696 S766P probably damaging Het
Shmt1 T C 11: 60,792,976 T337A probably benign Het
St5 G T 7: 109,525,620 R1068S possibly damaging Het
Tbc1d4 A T 14: 101,449,209 I1168N probably damaging Het
Tecpr2 T C 12: 110,946,343 V1126A probably benign Het
Tep1 A T 14: 50,829,230 S2304T possibly damaging Het
Tiam1 C A 16: 89,789,561 R1446M probably damaging Het
Tmem87a T C 2: 120,370,484 I425V probably benign Het
Ubr3 T C 2: 69,951,421 probably benign Het
Ubxn7 T A 16: 32,381,763 probably benign Het
Vmn2r13 A G 5: 109,156,847 S573P probably damaging Het
Wdfy3 A T 5: 101,957,388 V191E probably damaging Het
Zdhhc3 A T 9: 123,083,623 C153* probably null Het
Zfp407 A T 18: 84,209,022 V2154D probably damaging Het
Zfp407 A G 18: 84,209,346 V2046A probably benign Het
Zfr T A 15: 12,140,548 I227N unknown Het
Other mutations in Agap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Agap2 APN 10 127087996 missense unknown
IGL01690:Agap2 APN 10 127082958 splice site probably benign
IGL01765:Agap2 APN 10 127083235 missense unknown
IGL02029:Agap2 APN 10 127080283 missense unknown
IGL02525:Agap2 APN 10 127083201 splice site probably null
IGL03019:Agap2 APN 10 127091562 splice site probably benign
R0086:Agap2 UTSW 10 127087882 splice site probably null
R0197:Agap2 UTSW 10 127091702 missense possibly damaging 0.66
R0345:Agap2 UTSW 10 127087895 missense unknown
R0363:Agap2 UTSW 10 127090965 missense probably damaging 1.00
R0682:Agap2 UTSW 10 127083482 missense unknown
R0882:Agap2 UTSW 10 127087450 missense unknown
R0883:Agap2 UTSW 10 127091702 missense possibly damaging 0.66
R1445:Agap2 UTSW 10 127091112 splice site probably benign
R1800:Agap2 UTSW 10 127091671 missense probably damaging 1.00
R1854:Agap2 UTSW 10 127080516 missense unknown
R1925:Agap2 UTSW 10 127090875 missense probably damaging 1.00
R1986:Agap2 UTSW 10 127083044 nonsense probably null
R2050:Agap2 UTSW 10 127080261 nonsense probably null
R2267:Agap2 UTSW 10 127082428 splice site probably benign
R2269:Agap2 UTSW 10 127082428 splice site probably benign
R4174:Agap2 UTSW 10 127090514 missense probably damaging 0.98
R4397:Agap2 UTSW 10 127090483 missense unknown
R4418:Agap2 UTSW 10 127091650 missense probably damaging 1.00
R4472:Agap2 UTSW 10 127091213 missense probably damaging 1.00
R4612:Agap2 UTSW 10 127080096 missense unknown
R4690:Agap2 UTSW 10 127091375 missense possibly damaging 0.91
R4744:Agap2 UTSW 10 127090203 critical splice donor site probably null
R5316:Agap2 UTSW 10 127082427 splice site probably null
R5533:Agap2 UTSW 10 127083042 missense unknown
R5680:Agap2 UTSW 10 127088011 missense unknown
R6010:Agap2 UTSW 10 127090910 missense probably damaging 1.00
R6276:Agap2 UTSW 10 127089360 critical splice donor site probably null
R6356:Agap2 UTSW 10 127082996 missense unknown
Z1088:Agap2 UTSW 10 127088242 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGAGGACAGATCGTCTCCCACAC -3'
(R):5'- GACTGATTCTCCAGCCCAGAAAGC -3'

Sequencing Primer
(F):5'- CACACTCTAGCTTTGGGAGGTC -3'
(R):5'- CACAGAACTGGATACTGGGTCTC -3'
Posted On2013-10-16