Incidental Mutation 'R0787:Olfr770'
ID76910
Institutional Source Beutler Lab
Gene Symbol Olfr770
Ensembl Gene ENSMUSG00000047868
Gene Nameolfactory receptor 770
SynonymsMOR114-5, GA_x6K02T2PULF-10819232-10818297
MMRRC Submission 038967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R0787 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129132578-129138998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129133526 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 81 (N81D)
Ref Sequence ENSEMBL: ENSMUSP00000144960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062314] [ENSMUST00000203887] [ENSMUST00000204250] [ENSMUST00000204712]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062314
AA Change: N81D

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055193
Gene: ENSMUSG00000047868
AA Change: N81D

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.2e-43 PFAM
Pfam:7tm_1 38 286 5.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203887
AA Change: N81D

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144950
Gene: ENSMUSG00000047868
AA Change: N81D

DomainStartEndE-ValueType
Pfam:7tm_4 28 107 1.5e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204250
AA Change: N81D

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144892
Gene: ENSMUSG00000047868
AA Change: N81D

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.2e-43 PFAM
Pfam:7tm_1 38 286 5.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204712
AA Change: N81D

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144960
Gene: ENSMUSG00000047868
AA Change: N81D

DomainStartEndE-ValueType
Pfam:7tm_4 28 130 1.4e-17 PFAM
Pfam:7TM_GPCR_Srsx 32 130 2.4e-4 PFAM
Pfam:7tm_1 38 130 8.8e-16 PFAM
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T A 4: 107,890,129 L6Q probably damaging Het
1700001F09Rik A T 14: 43,345,493 probably null Het
Abca8a T A 11: 110,042,988 Y1197F possibly damaging Het
Abcc2 T C 19: 43,798,516 probably null Het
Adamts16 A T 13: 70,738,829 C979S probably damaging Het
Agap2 T A 10: 127,085,150 D523E unknown Het
Ankfy1 T A 11: 72,760,296 I1024N probably damaging Het
Ankrd13c A G 3: 157,994,678 S379G probably null Het
Arhgap40 T C 2: 158,547,790 S625P probably benign Het
Armc12 G C 17: 28,538,766 A291P probably damaging Het
Armc9 A G 1: 86,202,505 N524D probably damaging Het
Col12a1 G T 9: 79,638,485 T2305K probably damaging Het
Cyp2c54 T C 19: 40,047,635 N277S probably benign Het
E130311K13Rik A T 3: 63,920,298 V129E probably benign Het
Ehbp1l1 T C 19: 5,722,668 D79G possibly damaging Het
Epb41l1 A G 2: 156,494,090 E58G probably damaging Het
Fam217b T A 2: 178,420,909 V222E probably benign Het
Fat1 T A 8: 45,040,555 Y3913N probably damaging Het
Fgd4 A G 16: 16,423,901 probably benign Het
Hltf A T 3: 20,106,446 D759V probably damaging Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Isg15 C T 4: 156,199,939 R44H probably benign Het
Itga4 C T 2: 79,279,153 T232I probably benign Het
Kntc1 C A 5: 123,796,104 H1399Q probably benign Het
Lig1 A C 7: 13,299,069 K499Q probably benign Het
Lrrn3 C A 12: 41,454,231 C29F probably damaging Het
Mtmr10 T C 7: 64,300,615 I136T possibly damaging Het
Naip1 A G 13: 100,426,096 Y854H probably benign Het
Pcdh9 G A 14: 93,886,757 A659V possibly damaging Het
Phf20l1 T A 15: 66,615,630 probably benign Het
Phgdh A G 3: 98,334,549 V83A probably damaging Het
Pik3r1 A T 13: 101,690,523 M326K probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd1l2 T C 8: 117,076,177 D235G possibly damaging Het
Pkhd1l1 C A 15: 44,529,264 P1665Q probably damaging Het
Ppp1r7 A G 1: 93,364,956 T326A probably damaging Het
Prr22 A T 17: 56,771,072 Y75F possibly damaging Het
Ptov1 A C 7: 44,865,470 probably null Het
Rasal2 A G 1: 157,158,696 S766P probably damaging Het
Shmt1 T C 11: 60,792,976 T337A probably benign Het
St5 G T 7: 109,525,620 R1068S possibly damaging Het
Tbc1d4 A T 14: 101,449,209 I1168N probably damaging Het
Tecpr2 T C 12: 110,946,343 V1126A probably benign Het
Tep1 A T 14: 50,829,230 S2304T possibly damaging Het
Tiam1 C A 16: 89,789,561 R1446M probably damaging Het
Tmem87a T C 2: 120,370,484 I425V probably benign Het
Ubr3 T C 2: 69,951,421 probably benign Het
Ubxn7 T A 16: 32,381,763 probably benign Het
Vmn2r13 A G 5: 109,156,847 S573P probably damaging Het
Wdfy3 A T 5: 101,957,388 V191E probably damaging Het
Zdhhc3 A T 9: 123,083,623 C153* probably null Het
Zfp407 A T 18: 84,209,022 V2154D probably damaging Het
Zfp407 A G 18: 84,209,346 V2046A probably benign Het
Zfr T A 15: 12,140,548 I227N unknown Het
Other mutations in Olfr770
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2141:Olfr770 UTSW 10 129133006 missense probably benign 0.23
R4190:Olfr770 UTSW 10 129132967 missense possibly damaging 0.86
R4397:Olfr770 UTSW 10 129133581 missense possibly damaging 0.59
R5009:Olfr770 UTSW 10 129133615 missense probably benign 0.06
R5781:Olfr770 UTSW 10 129133147 missense probably damaging 1.00
R6343:Olfr770 UTSW 10 129133666 nonsense probably null
Z1088:Olfr770 UTSW 10 129133075 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TCTTCAGGAAGGGAGACACATCACA -3'
(R):5'- TCCACAAATTCAAAGCCTGCTTTTGATT -3'

Sequencing Primer
(F):5'- TGGCAGTATGATGATCACCC -3'
(R):5'- AAAGCCTGCTTTTGATTTTTCTCC -3'
Posted On2013-10-16