Incidental Mutation 'R0787:Abca8a'
ID76913
Institutional Source Beutler Lab
Gene Symbol Abca8a
Ensembl Gene ENSMUSG00000041828
Gene NameATP-binding cassette, sub-family A (ABC1), member 8a
Synonyms
MMRRC Submission 038967-MU
Accession Numbers

Genbank: NM_153145

Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0787 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location110025634-110095978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110042988 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1197 (Y1197F)
Ref Sequence ENSEMBL: ENSMUSP00000102275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046223] [ENSMUST00000100287] [ENSMUST00000106664]
Predicted Effect probably benign
Transcript: ENSMUST00000046223
AA Change: Y1196F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045808
Gene: ENSMUSG00000041828
AA Change: Y1196F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 8e-26 PFAM
AAA 505 689 6.27e-9 SMART
Pfam:ABC2_membrane_3 860 1174 6.8e-15 PFAM
transmembrane domain 1196 1218 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AAA 1313 1493 4.3e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100287
AA Change: Y1197F

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097860
Gene: ENSMUSG00000041828
AA Change: Y1197F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 3.9e-26 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1175 3.3e-15 PFAM
transmembrane domain 1197 1219 N/A INTRINSIC
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106664
AA Change: Y1197F

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102275
Gene: ENSMUSG00000041828
AA Change: Y1197F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.7e-23 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1214 1.3e-12 PFAM
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T A 4: 107,890,129 L6Q probably damaging Het
1700001F09Rik A T 14: 43,345,493 probably null Het
Abcc2 T C 19: 43,798,516 probably null Het
Adamts16 A T 13: 70,738,829 C979S probably damaging Het
Agap2 T A 10: 127,085,150 D523E unknown Het
Ankfy1 T A 11: 72,760,296 I1024N probably damaging Het
Ankrd13c A G 3: 157,994,678 S379G probably null Het
Arhgap40 T C 2: 158,547,790 S625P probably benign Het
Armc12 G C 17: 28,538,766 A291P probably damaging Het
Armc9 A G 1: 86,202,505 N524D probably damaging Het
Col12a1 G T 9: 79,638,485 T2305K probably damaging Het
Cyp2c54 T C 19: 40,047,635 N277S probably benign Het
E130311K13Rik A T 3: 63,920,298 V129E probably benign Het
Ehbp1l1 T C 19: 5,722,668 D79G possibly damaging Het
Epb41l1 A G 2: 156,494,090 E58G probably damaging Het
Fam217b T A 2: 178,420,909 V222E probably benign Het
Fat1 T A 8: 45,040,555 Y3913N probably damaging Het
Fgd4 A G 16: 16,423,901 probably benign Het
Hltf A T 3: 20,106,446 D759V probably damaging Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Isg15 C T 4: 156,199,939 R44H probably benign Het
Itga4 C T 2: 79,279,153 T232I probably benign Het
Kntc1 C A 5: 123,796,104 H1399Q probably benign Het
Lig1 A C 7: 13,299,069 K499Q probably benign Het
Lrrn3 C A 12: 41,454,231 C29F probably damaging Het
Mtmr10 T C 7: 64,300,615 I136T possibly damaging Het
Naip1 A G 13: 100,426,096 Y854H probably benign Het
Olfr770 T C 10: 129,133,526 N81D possibly damaging Het
Pcdh9 G A 14: 93,886,757 A659V possibly damaging Het
Phf20l1 T A 15: 66,615,630 probably benign Het
Phgdh A G 3: 98,334,549 V83A probably damaging Het
Pik3r1 A T 13: 101,690,523 M326K probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd1l2 T C 8: 117,076,177 D235G possibly damaging Het
Pkhd1l1 C A 15: 44,529,264 P1665Q probably damaging Het
Ppp1r7 A G 1: 93,364,956 T326A probably damaging Het
Prr22 A T 17: 56,771,072 Y75F possibly damaging Het
Ptov1 A C 7: 44,865,470 probably null Het
Rasal2 A G 1: 157,158,696 S766P probably damaging Het
Shmt1 T C 11: 60,792,976 T337A probably benign Het
St5 G T 7: 109,525,620 R1068S possibly damaging Het
Tbc1d4 A T 14: 101,449,209 I1168N probably damaging Het
Tecpr2 T C 12: 110,946,343 V1126A probably benign Het
Tep1 A T 14: 50,829,230 S2304T possibly damaging Het
Tiam1 C A 16: 89,789,561 R1446M probably damaging Het
Tmem87a T C 2: 120,370,484 I425V probably benign Het
Ubr3 T C 2: 69,951,421 probably benign Het
Ubxn7 T A 16: 32,381,763 probably benign Het
Vmn2r13 A G 5: 109,156,847 S573P probably damaging Het
Wdfy3 A T 5: 101,957,388 V191E probably damaging Het
Zdhhc3 A T 9: 123,083,623 C153* probably null Het
Zfp407 A T 18: 84,209,022 V2154D probably damaging Het
Zfp407 A G 18: 84,209,346 V2046A probably benign Het
Zfr T A 15: 12,140,548 I227N unknown Het
Other mutations in Abca8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca8a APN 11 110050939 missense possibly damaging 0.52
IGL01099:Abca8a APN 11 110074205 splice site probably benign
IGL01100:Abca8a APN 11 110058423 critical splice donor site probably null
IGL01310:Abca8a APN 11 110059975 missense probably benign 0.02
IGL01357:Abca8a APN 11 110031572 missense probably benign 0.05
IGL01554:Abca8a APN 11 110042166 missense probably benign 0.24
IGL01937:Abca8a APN 11 110083304 splice site probably benign
IGL01945:Abca8a APN 11 110083304 splice site probably benign
IGL01987:Abca8a APN 11 110074155 missense possibly damaging 0.63
IGL02023:Abca8a APN 11 110063116 missense probably benign 0.04
IGL02208:Abca8a APN 11 110059946 missense probably damaging 1.00
IGL02378:Abca8a APN 11 110078815 unclassified probably benign
IGL02380:Abca8a APN 11 110078815 unclassified probably benign
IGL02387:Abca8a APN 11 110078815 unclassified probably benign
IGL02388:Abca8a APN 11 110078815 unclassified probably benign
IGL02524:Abca8a APN 11 110078815 unclassified probably benign
IGL02551:Abca8a APN 11 110084242 missense probably benign 0.05
IGL02831:Abca8a APN 11 110053081 missense probably damaging 1.00
IGL02836:Abca8a APN 11 110070351 missense possibly damaging 0.89
IGL02934:Abca8a APN 11 110040588 missense probably damaging 1.00
IGL02946:Abca8a APN 11 110028215 splice site probably benign
IGL02967:Abca8a APN 11 110050936 missense probably damaging 1.00
IGL02997:Abca8a APN 11 110075533 splice site probably benign
IGL03265:Abca8a APN 11 110053103 missense probably benign 0.01
G5030:Abca8a UTSW 11 110070339 missense probably damaging 1.00
H8562:Abca8a UTSW 11 110043009 missense probably benign
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0084:Abca8a UTSW 11 110036597 splice site probably benign
R0394:Abca8a UTSW 11 110026343 missense probably damaging 0.99
R0477:Abca8a UTSW 11 110065225 missense probably benign
R0593:Abca8a UTSW 11 110068099 missense probably damaging 1.00
R0744:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0764:Abca8a UTSW 11 110059946 missense probably damaging 1.00
R0836:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0848:Abca8a UTSW 11 110028190 missense probably damaging 1.00
R0894:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1163:Abca8a UTSW 11 110071530 missense probably benign 0.01
R1224:Abca8a UTSW 11 110040582 missense probably damaging 1.00
R1474:Abca8a UTSW 11 110069809 missense probably damaging 1.00
R1596:Abca8a UTSW 11 110068060 missense possibly damaging 0.89
R1708:Abca8a UTSW 11 110053102 missense probably damaging 1.00
R1715:Abca8a UTSW 11 110091580 missense probably damaging 0.98
R1795:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1832:Abca8a UTSW 11 110071451 missense probably damaging 0.99
R1852:Abca8a UTSW 11 110069386 missense probably damaging 1.00
R1887:Abca8a UTSW 11 110089942 missense probably damaging 1.00
R1891:Abca8a UTSW 11 110091607 missense probably benign 0.20
R1917:Abca8a UTSW 11 110091515 splice site probably benign
R1943:Abca8a UTSW 11 110069863 missense probably benign 0.00
R1962:Abca8a UTSW 11 110026905 critical splice acceptor site probably null
R2016:Abca8a UTSW 11 110070387 missense probably damaging 0.99
R2037:Abca8a UTSW 11 110089984 intron probably null
R2098:Abca8a UTSW 11 110036579 missense probably damaging 1.00
R2102:Abca8a UTSW 11 110068052 missense probably damaging 1.00
R2134:Abca8a UTSW 11 110030917 missense probably null 1.00
R2220:Abca8a UTSW 11 110026855 missense probably damaging 1.00
R2269:Abca8a UTSW 11 110026892 missense probably damaging 1.00
R2395:Abca8a UTSW 11 110068788 missense probably damaging 1.00
R2847:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R2849:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R3508:Abca8a UTSW 11 110063165 missense probably benign
R3974:Abca8a UTSW 11 110083502 missense probably damaging 1.00
R4009:Abca8a UTSW 11 110090107 missense probably damaging 0.98
R4163:Abca8a UTSW 11 110050982 missense probably benign 0.00
R4274:Abca8a UTSW 11 110090104 missense probably damaging 0.96
R4507:Abca8a UTSW 11 110063025 missense probably benign 0.19
R4571:Abca8a UTSW 11 110030058 missense probably damaging 1.00
R4672:Abca8a UTSW 11 110071876 missense possibly damaging 0.94
R4700:Abca8a UTSW 11 110070482 missense probably damaging 1.00
R4770:Abca8a UTSW 11 110071515 missense possibly damaging 0.82
R4946:Abca8a UTSW 11 110086474 missense probably damaging 1.00
R4955:Abca8a UTSW 11 110036512 missense probably benign 0.00
R5186:Abca8a UTSW 11 110091599 missense probably null 0.31
R5190:Abca8a UTSW 11 110089909 critical splice donor site probably null
R5597:Abca8a UTSW 11 110036537 missense probably damaging 1.00
R5677:Abca8a UTSW 11 110038399 missense possibly damaging 0.51
R5757:Abca8a UTSW 11 110042968 missense probably benign 0.28
R5822:Abca8a UTSW 11 110030879 missense probably damaging 0.98
R5925:Abca8a UTSW 11 110057223 missense probably damaging 1.00
R6090:Abca8a UTSW 11 110063222 critical splice acceptor site probably null
R6122:Abca8a UTSW 11 110070423 missense probably benign 0.40
R6189:Abca8a UTSW 11 110030884 missense probably damaging 1.00
R6200:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R6374:Abca8a UTSW 11 110083390 nonsense probably null
X0022:Abca8a UTSW 11 110031097 missense probably damaging 1.00
X0024:Abca8a UTSW 11 110083335 missense probably damaging 1.00
X0053:Abca8a UTSW 11 110083484 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACGTCATCCATACTTTAGGATGCACC -3'
(R):5'- AGTTGGTACTTCCTTTGTGCCCAAG -3'

Sequencing Primer
(F):5'- aatttacccattaatccatttcccc -3'
(R):5'- CTTTGTGCCCAAGGAAAAATCTG -3'
Posted On2013-10-16