Incidental Mutation 'R0787:Zfp407'
ID76932
Institutional Source Beutler Lab
Gene Symbol Zfp407
Ensembl Gene ENSMUSG00000048410
Gene Namezinc finger protein 407
Synonyms6430585N13Rik, LOC240469, LOC381139
MMRRC Submission 038967-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R0787 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location84128027-84589725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84209022 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 2154 (V2154D)
Ref Sequence ENSEMBL: ENSMUSP00000118361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125763]
Predicted Effect probably benign
Transcript: ENSMUST00000125450
Predicted Effect probably damaging
Transcript: ENSMUST00000125763
AA Change: V2154D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: V2154D

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
ZnF_C2H2 178 200 8.67e-1 SMART
ZnF_U1 233 267 6.79e-1 SMART
ZnF_C2H2 236 260 4.65e-1 SMART
ZnF_C2H2 522 545 7.05e-1 SMART
ZnF_U1 548 582 1.54e1 SMART
ZnF_C2H2 551 575 1.01e-1 SMART
ZnF_C2H2 582 605 1.41e0 SMART
ZnF_U1 606 639 2.22e0 SMART
ZnF_C2H2 609 632 1.01e2 SMART
ZnF_C2H2 695 718 6.23e-2 SMART
ZnF_U1 721 755 2.96e0 SMART
ZnF_C2H2 724 748 7.11e0 SMART
ZnF_C2H2 840 863 7.55e-1 SMART
ZnF_U1 866 900 3.81e-1 SMART
ZnF_C2H2 869 893 1.07e0 SMART
ZnF_C2H2 1009 1032 6.13e-1 SMART
ZnF_U1 1035 1069 2.22e0 SMART
ZnF_C2H2 1038 1062 5.62e0 SMART
low complexity region 1223 1234 N/A INTRINSIC
ZnF_C2H2 1405 1428 5.92e0 SMART
ZnF_U1 1432 1466 2.35e0 SMART
ZnF_C2H2 1435 1459 1.76e-1 SMART
ZnF_C2H2 1477 1500 5.42e-2 SMART
ZnF_C2H2 1528 1552 1.68e1 SMART
ZnF_C2H2 1558 1580 1.43e-1 SMART
ZnF_C2H2 1586 1609 9.58e-3 SMART
ZnF_C2H2 1619 1641 2.61e-4 SMART
ZnF_C2H2 1647 1671 1.04e-3 SMART
ZnF_C2H2 1677 1699 9.44e-2 SMART
ZnF_C2H2 1705 1727 1.82e-3 SMART
ZnF_C2H2 1733 1758 4.65e-1 SMART
ZnF_C2H2 1764 1787 1.26e-2 SMART
low complexity region 1876 1887 N/A INTRINSIC
low complexity region 2017 2032 N/A INTRINSIC
Meta Mutation Damage Score 0.0328 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T A 4: 107,890,129 L6Q probably damaging Het
1700001F09Rik A T 14: 43,345,493 probably null Het
Abca8a T A 11: 110,042,988 Y1197F possibly damaging Het
Abcc2 T C 19: 43,798,516 probably null Het
Adamts16 A T 13: 70,738,829 C979S probably damaging Het
Agap2 T A 10: 127,085,150 D523E unknown Het
Ankfy1 T A 11: 72,760,296 I1024N probably damaging Het
Ankrd13c A G 3: 157,994,678 S379G probably null Het
Arhgap40 T C 2: 158,547,790 S625P probably benign Het
Armc12 G C 17: 28,538,766 A291P probably damaging Het
Armc9 A G 1: 86,202,505 N524D probably damaging Het
Col12a1 G T 9: 79,638,485 T2305K probably damaging Het
Cyp2c54 T C 19: 40,047,635 N277S probably benign Het
E130311K13Rik A T 3: 63,920,298 V129E probably benign Het
Ehbp1l1 T C 19: 5,722,668 D79G possibly damaging Het
Epb41l1 A G 2: 156,494,090 E58G probably damaging Het
Fam217b T A 2: 178,420,909 V222E probably benign Het
Fat1 T A 8: 45,040,555 Y3913N probably damaging Het
Fgd4 A G 16: 16,423,901 probably benign Het
Hltf A T 3: 20,106,446 D759V probably damaging Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Isg15 C T 4: 156,199,939 R44H probably benign Het
Itga4 C T 2: 79,279,153 T232I probably benign Het
Kntc1 C A 5: 123,796,104 H1399Q probably benign Het
Lig1 A C 7: 13,299,069 K499Q probably benign Het
Lrrn3 C A 12: 41,454,231 C29F probably damaging Het
Mtmr10 T C 7: 64,300,615 I136T possibly damaging Het
Naip1 A G 13: 100,426,096 Y854H probably benign Het
Olfr770 T C 10: 129,133,526 N81D possibly damaging Het
Pcdh9 G A 14: 93,886,757 A659V possibly damaging Het
Phf20l1 T A 15: 66,615,630 probably benign Het
Phgdh A G 3: 98,334,549 V83A probably damaging Het
Pik3r1 A T 13: 101,690,523 M326K probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd1l2 T C 8: 117,076,177 D235G possibly damaging Het
Pkhd1l1 C A 15: 44,529,264 P1665Q probably damaging Het
Ppp1r7 A G 1: 93,364,956 T326A probably damaging Het
Prr22 A T 17: 56,771,072 Y75F possibly damaging Het
Ptov1 A C 7: 44,865,470 probably null Het
Rasal2 A G 1: 157,158,696 S766P probably damaging Het
Shmt1 T C 11: 60,792,976 T337A probably benign Het
St5 G T 7: 109,525,620 R1068S possibly damaging Het
Tbc1d4 A T 14: 101,449,209 I1168N probably damaging Het
Tecpr2 T C 12: 110,946,343 V1126A probably benign Het
Tep1 A T 14: 50,829,230 S2304T possibly damaging Het
Tiam1 C A 16: 89,789,561 R1446M probably damaging Het
Tmem87a T C 2: 120,370,484 I425V probably benign Het
Ubr3 T C 2: 69,951,421 probably benign Het
Ubxn7 T A 16: 32,381,763 probably benign Het
Vmn2r13 A G 5: 109,156,847 S573P probably damaging Het
Wdfy3 A T 5: 101,957,388 V191E probably damaging Het
Zdhhc3 A T 9: 123,083,623 C153* probably null Het
Zfr T A 15: 12,140,548 I227N unknown Het
Other mutations in Zfp407
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp407 APN 18 84561752 missense probably damaging 0.99
IGL02105:Zfp407 APN 18 84562720 nonsense probably null
IGL02110:Zfp407 APN 18 84559040 missense probably benign 0.00
IGL02343:Zfp407 APN 18 84209724 missense possibly damaging 0.71
IGL02456:Zfp407 APN 18 84558641 missense probably damaging 1.00
IGL02705:Zfp407 APN 18 84559031 nonsense probably null
IGL02946:Zfp407 APN 18 84560709 missense probably damaging 1.00
IGL03069:Zfp407 APN 18 84350975 missense probably damaging 1.00
IGL03145:Zfp407 APN 18 84209721 missense probably damaging 0.99
IGL03403:Zfp407 APN 18 84560797 missense probably damaging 1.00
IGL03134:Zfp407 UTSW 18 84209955 missense probably damaging 0.99
R0087:Zfp407 UTSW 18 84560411 missense probably damaging 1.00
R0243:Zfp407 UTSW 18 84558711 missense probably damaging 1.00
R0594:Zfp407 UTSW 18 84562567 missense possibly damaging 0.87
R0766:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R0787:Zfp407 UTSW 18 84209346 missense probably benign 0.00
R1065:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1086:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1165:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1186:Zfp407 UTSW 18 84209448 missense probably benign 0.39
R1203:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1312:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1345:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1385:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1421:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1430:Zfp407 UTSW 18 84209455 missense probably benign 0.18
R1436:Zfp407 UTSW 18 84343071 splice site probably benign
R1498:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1526:Zfp407 UTSW 18 84561033 missense possibly damaging 0.61
R1579:Zfp407 UTSW 18 84209638 missense probably benign 0.00
R1594:Zfp407 UTSW 18 84209331 missense probably benign 0.01
R1628:Zfp407 UTSW 18 84354533 missense probably damaging 1.00
R1698:Zfp407 UTSW 18 84562157 missense probably damaging 1.00
R1962:Zfp407 UTSW 18 84559336 missense probably benign 0.01
R1984:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1985:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1986:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R2151:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2152:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2154:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2259:Zfp407 UTSW 18 84209793 missense probably damaging 1.00
R2353:Zfp407 UTSW 18 84559880 missense probably damaging 1.00
R2845:Zfp407 UTSW 18 84558397 nonsense probably null
R3407:Zfp407 UTSW 18 84558872 missense probably benign 0.08
R3432:Zfp407 UTSW 18 84208746 missense probably damaging 1.00
R3892:Zfp407 UTSW 18 84560352 missense probably damaging 1.00
R4026:Zfp407 UTSW 18 84559596 missense possibly damaging 0.82
R4107:Zfp407 UTSW 18 84343007 missense possibly damaging 0.82
R4398:Zfp407 UTSW 18 84562731 nonsense probably null
R4447:Zfp407 UTSW 18 84562694 missense possibly damaging 0.95
R4752:Zfp407 UTSW 18 84562914 missense probably benign 0.01
R4881:Zfp407 UTSW 18 84559703 missense probably benign 0.27
R4936:Zfp407 UTSW 18 84559464 missense probably benign 0.00
R5194:Zfp407 UTSW 18 84561309 missense probably benign 0.05
R5243:Zfp407 UTSW 18 84561091 missense probably damaging 1.00
R5258:Zfp407 UTSW 18 84315926 missense probably damaging 1.00
R5591:Zfp407 UTSW 18 84561137 missense probably damaging 1.00
R5633:Zfp407 UTSW 18 84561044 missense probably benign 0.35
R5739:Zfp407 UTSW 18 84208742 makesense probably null
R5806:Zfp407 UTSW 18 84558614 missense probably damaging 1.00
R5820:Zfp407 UTSW 18 84560524 missense probably benign 0.01
R6187:Zfp407 UTSW 18 84559009 missense possibly damaging 0.87
R6512:Zfp407 UTSW 18 84560349 missense probably damaging 1.00
R6521:Zfp407 UTSW 18 84432411 missense probably damaging 1.00
R6748:Zfp407 UTSW 18 84208830 missense probably damaging 0.98
R6882:Zfp407 UTSW 18 84343069 splice site probably null
R6899:Zfp407 UTSW 18 84561434 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATGCTCGTCAACTGTTCCGTGCTG -3'
(R):5'- AAGAAGATGGTTCAGGGAGTCCTGC -3'

Sequencing Primer
(F):5'- TTCCGTGCTGCTGGAAC -3'
(R):5'- AGGATGGCGTTACTCAAGTC -3'
Posted On2013-10-16