Incidental Mutation 'R0771:Srbd1'
ID76968
Institutional Source Beutler Lab
Gene Symbol Srbd1
Ensembl Gene ENSMUSG00000024135
Gene NameS1 RNA binding domain 1
Synonyms
MMRRC Submission 038951-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R0771 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location85984665-86145175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86130254 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 220 (E220D)
Ref Sequence ENSEMBL: ENSMUSP00000092810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095187]
Predicted Effect probably benign
Transcript: ENSMUST00000095187
AA Change: E220D

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092810
Gene: ENSMUSG00000024135
AA Change: E220D

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
low complexity region 104 128 N/A INTRINSIC
Pfam:Tex_N 213 403 2.8e-43 PFAM
YqgFc 532 631 4.1e-32 SMART
Pfam:HHH_7 668 764 1.6e-6 PFAM
Pfam:HHH_3 698 762 4.2e-25 PFAM
S1 903 978 7e-15 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,455,683 E434G probably damaging Het
Adam19 G A 11: 46,121,453 V259I possibly damaging Het
Adam5 A G 8: 24,786,299 S451P probably benign Het
Chd6 G A 2: 161,019,580 L516F probably damaging Het
Elovl4 A G 9: 83,785,115 V154A possibly damaging Het
Gadl1 G A 9: 115,944,232 R114Q probably damaging Het
Gm5065 A G 7: 5,359,823 D151G probably damaging Het
Gm9733 T A 3: 15,320,446 Q132L probably benign Het
Ipo13 T C 4: 117,894,646 N936S possibly damaging Het
Kcnd2 T A 6: 21,216,442 S48R probably damaging Het
Lim2 C A 7: 43,430,703 A38E possibly damaging Het
Lrp2 A T 2: 69,507,990 D1177E probably damaging Het
Mdh1 C T 11: 21,557,550 V300I probably benign Het
Mfsd4b4 T C 10: 39,892,411 T275A probably benign Het
Myo10 A G 15: 25,778,178 Y114C probably damaging Het
Ncapg2 T A 12: 116,413,159 C122* probably null Het
Nod1 T G 6: 54,944,269 S355R probably damaging Het
Olfr1020 A T 2: 85,849,994 I181F possibly damaging Het
Olfr686 T A 7: 105,204,161 M61L possibly damaging Het
Pcsk1 A T 13: 75,132,162 E702V probably benign Het
Ptpn21 T C 12: 98,689,080 T543A probably damaging Het
Ranbp9 T C 13: 43,461,773 I190V possibly damaging Het
Slc1a4 C T 11: 20,306,467 V455M probably damaging Het
Thsd7a A G 6: 12,327,577 V1432A probably benign Het
Zfp61 T C 7: 24,293,354 R71G probably benign Het
Other mutations in Srbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Srbd1 APN 17 86115209 missense probably damaging 1.00
IGL00988:Srbd1 APN 17 86130270 missense probably damaging 0.96
IGL01111:Srbd1 APN 17 86098533 missense probably benign 0.15
IGL02186:Srbd1 APN 17 86109231 missense probably benign
IGL02233:Srbd1 APN 17 86098622 splice site probably null
IGL02307:Srbd1 APN 17 86126188 missense probably damaging 1.00
IGL02392:Srbd1 APN 17 85988373 missense probably benign 0.34
IGL02831:Srbd1 APN 17 86003871 missense probably damaging 1.00
IGL03299:Srbd1 APN 17 86120659 missense possibly damaging 0.95
PIT4494001:Srbd1 UTSW 17 86142359 critical splice donor site probably null
PIT4677001:Srbd1 UTSW 17 86115212 nonsense probably null
R0233:Srbd1 UTSW 17 86057745 missense probably damaging 1.00
R0233:Srbd1 UTSW 17 86057745 missense probably damaging 1.00
R0464:Srbd1 UTSW 17 86120002 missense probably damaging 1.00
R0692:Srbd1 UTSW 17 86136460 missense probably benign 0.25
R1074:Srbd1 UTSW 17 86003952 missense probably damaging 1.00
R1173:Srbd1 UTSW 17 86098512 missense probably null 1.00
R1446:Srbd1 UTSW 17 86139152 missense probably benign 0.44
R1587:Srbd1 UTSW 17 85985437 missense probably damaging 1.00
R1780:Srbd1 UTSW 17 86057685 missense probably damaging 1.00
R1865:Srbd1 UTSW 17 86115304 splice site probably benign
R1933:Srbd1 UTSW 17 86102893 missense probably damaging 1.00
R1934:Srbd1 UTSW 17 86102893 missense probably damaging 1.00
R2002:Srbd1 UTSW 17 86142400 missense probably benign
R2228:Srbd1 UTSW 17 85985223 missense probably damaging 1.00
R3160:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3162:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3162:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3439:Srbd1 UTSW 17 86057759 missense probably benign 0.01
R3611:Srbd1 UTSW 17 86102927 missense probably benign 0.03
R4255:Srbd1 UTSW 17 86102922 missense possibly damaging 0.80
R4300:Srbd1 UTSW 17 85985204 missense probably damaging 0.98
R4319:Srbd1 UTSW 17 86051150 missense probably damaging 1.00
R4619:Srbd1 UTSW 17 86109265 missense probably benign 0.30
R4620:Srbd1 UTSW 17 86109265 missense probably benign 0.30
R4629:Srbd1 UTSW 17 86120672 missense probably damaging 0.99
R5379:Srbd1 UTSW 17 86001536 missense possibly damaging 0.88
R5469:Srbd1 UTSW 17 86119942 missense possibly damaging 0.77
R5587:Srbd1 UTSW 17 86127801 missense probably damaging 0.99
R5726:Srbd1 UTSW 17 86120729 missense possibly damaging 0.89
R6166:Srbd1 UTSW 17 86099268 missense probably damaging 1.00
R6237:Srbd1 UTSW 17 85985295 missense probably damaging 0.99
R6696:Srbd1 UTSW 17 86139191 missense possibly damaging 0.46
R6971:Srbd1 UTSW 17 86099290 missense possibly damaging 0.79
R6986:Srbd1 UTSW 17 85985222 missense probably damaging 1.00
R7018:Srbd1 UTSW 17 86136415 missense possibly damaging 0.93
R7082:Srbd1 UTSW 17 86057732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTCATGTCAAGAGCCCACAGC -3'
(R):5'- AGCCAAGCCTGGAGAGAGTTTAGC -3'

Sequencing Primer
(F):5'- AAGAGCCCACAGCTTGTTTC -3'
(R):5'- CCTGGAGAGAGTTTAGCCATTTAC -3'
Posted On2013-10-16