Incidental Mutation 'R0774:Leng8'
ID76979
Institutional Source Beutler Lab
Gene Symbol Leng8
Ensembl Gene ENSMUSG00000035545
Gene Nameleukocyte receptor cluster (LRC) member 8
Synonyms
MMRRC Submission 038954-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0774 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4137039-4148177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4142136 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 178 (H178Q)
Ref Sequence ENSEMBL: ENSMUSP00000118832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037472] [ENSMUST00000117274] [ENSMUST00000121270] [ENSMUST00000128756] [ENSMUST00000132086] [ENSMUST00000144248] [ENSMUST00000154571]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037472
AA Change: H178Q

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046465
Gene: ENSMUSG00000035545
AA Change: H178Q

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 762 8.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117274
SMART Domains Protein: ENSMUSP00000113223
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 104 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121270
AA Change: H178Q

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112428
Gene: ENSMUSG00000035545
AA Change: H178Q

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 764 7.4e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127723
Predicted Effect probably damaging
Transcript: ENSMUST00000128756
AA Change: H178Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118832
Gene: ENSMUSG00000035545
AA Change: H178Q

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132086
SMART Domains Protein: ENSMUSP00000121129
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 29 51 N/A INTRINSIC
low complexity region 63 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144248
SMART Domains Protein: ENSMUSP00000120574
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 104 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
low complexity region 346 359 N/A INTRINSIC
low complexity region 376 410 N/A INTRINSIC
low complexity region 416 431 N/A INTRINSIC
Pfam:SAC3_GANP 530 725 1e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146434
Predicted Effect probably benign
Transcript: ENSMUST00000154571
SMART Domains Protein: ENSMUSP00000123328
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155881
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.8%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 7 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdhr2 C T 13: 54,717,855 S222F probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Psip1 CACTTACT CACT 4: 83,460,452 probably null Het
Shox2 C T 3: 66,973,811 A279T probably damaging Het
Sis T C 3: 72,952,531 Q297R probably damaging Het
Slc1a6 G T 10: 78,812,824 V460L probably benign Het
St5 C T 7: 109,542,320 probably null Het
Other mutations in Leng8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Leng8 APN 7 4145482 missense probably benign 0.03
IGL02437:Leng8 APN 7 4142093 missense probably damaging 0.99
R0104:Leng8 UTSW 7 4143808 missense probably damaging 0.99
R1696:Leng8 UTSW 7 4145136 missense probably damaging 1.00
R2001:Leng8 UTSW 7 4145074 missense probably damaging 1.00
R2012:Leng8 UTSW 7 4143610 missense probably damaging 1.00
R2054:Leng8 UTSW 7 4144290 nonsense probably null
R3433:Leng8 UTSW 7 4142132 missense probably benign 0.22
R4335:Leng8 UTSW 7 4147038 missense probably damaging 0.99
R4607:Leng8 UTSW 7 4144797 missense probably damaging 1.00
R4608:Leng8 UTSW 7 4144797 missense probably damaging 1.00
R4886:Leng8 UTSW 7 4144931 unclassified probably null
R5307:Leng8 UTSW 7 4145473 missense probably damaging 1.00
R5339:Leng8 UTSW 7 4145286 missense possibly damaging 0.96
R5368:Leng8 UTSW 7 4139988 missense probably damaging 0.97
R5370:Leng8 UTSW 7 4145434 missense possibly damaging 0.48
R5615:Leng8 UTSW 7 4144958 nonsense probably null
R5645:Leng8 UTSW 7 4145274 missense probably damaging 1.00
R5750:Leng8 UTSW 7 4142120 missense probably benign 0.04
R6041:Leng8 UTSW 7 4145569 missense probably benign 0.01
R6054:Leng8 UTSW 7 4145523 unclassified probably null
R6481:Leng8 UTSW 7 4145413 missense probably damaging 1.00
R6826:Leng8 UTSW 7 4145320 missense probably damaging 1.00
R6919:Leng8 UTSW 7 4143626 missense possibly damaging 0.82
R7313:Leng8 UTSW 7 4139526 missense possibly damaging 0.73
R7357:Leng8 UTSW 7 4144933 nonsense probably null
R7428:Leng8 UTSW 7 4143573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGATGTGCTCAAGAGAGGGAAC -3'
(R):5'- TTCATGCGGGTCCATAACTGCTG -3'

Sequencing Primer
(F):5'- tgaaaatacataccccagggag -3'
(R):5'- GACCCTTCTTAGGTTTGGCAG -3'
Posted On2013-10-16