Incidental Mutation 'R0847:AI314180'
ID77002
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R0847 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58841439 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 645 (T645I)
Ref Sequence ENSEMBL: ENSMUSP00000103182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000107557] [ENSMUST00000144512] [ENSMUST00000149301]
Predicted Effect probably benign
Transcript: ENSMUST00000102889
AA Change: T645I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: T645I

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107557
AA Change: T645I

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103182
Gene: ENSMUSG00000050812
AA Change: T645I

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 7.6e-164 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144512
SMART Domains Protein: ENSMUSP00000118103
Gene: ENSMUSG00000050812

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 2.3e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149301
AA Change: T645I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812
AA Change: T645I

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151869
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0399:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R0487:AI314180 UTSW 4 58819155 missense probably damaging 1.00
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2029:AI314180 UTSW 4 58844165 nonsense probably null
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2902:AI314180 UTSW 4 58809691 missense probably benign 0.31
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R2925:AI314180 UTSW 4 58833928 nonsense probably null
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4576:AI314180 UTSW 4 58834708 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4654:AI314180 UTSW 4 58834523 missense possibly damaging 0.86
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6298:AI314180 UTSW 4 58877157 missense probably damaging 1.00
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6478:AI314180 UTSW 4 58810785 missense probably damaging 1.00
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
R7088:AI314180 UTSW 4 58849766 missense possibly damaging 0.93
R7302:AI314180 UTSW 4 58834593 missense probably benign 0.43
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CCATGAGTTTGGAACCTACCCACTG -3'
(R):5'- AGCATATTGAACCTTGCTTCCTGGC -3'

Sequencing Primer
(F):5'- TACCCACTGAGCCAGATGG -3'
(R):5'- ttggggctggagaggac -3'
Posted On2013-10-16