Incidental Mutation 'R0847:Sri'
ID77006
Institutional Source Beutler Lab
Gene Symbol Sri
Ensembl Gene ENSMUSG00000003161
Gene Namesorcin
SynonymsSor, 2210417O06Rik, 2900070H08Rik
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R0847 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8046078-8069379 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 8063755 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088786] [ENSMUST00000148633]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000003245
Predicted Effect probably null
Transcript: ENSMUST00000088786
SMART Domains Protein: ENSMUSP00000086165
Gene: ENSMUSG00000003161

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EF-hand_5 30 43 8.7e-4 PFAM
EFh 59 87 6.75e0 SMART
EFh 89 117 1.02e-2 SMART
Blast:EFh 153 183 9e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144265
Predicted Effect probably null
Transcript: ENSMUST00000148633
SMART Domains Protein: ENSMUSP00000118221
Gene: ENSMUSG00000003161

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
Pfam:EF-hand_5 45 58 9.6e-4 PFAM
EFh 74 102 6.75e0 SMART
EFh 104 132 1.02e-2 SMART
Blast:EFh 168 198 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197065
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Sri
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Sri APN 5 8063755 splice site probably null
IGL02442:Sri APN 5 8062411 missense probably damaging 1.00
IGL02661:Sri APN 5 8063252 splice site probably benign
IGL02675:Sri APN 5 8067534 missense probably damaging 1.00
R0973:Sri UTSW 5 8059381 missense probably damaging 1.00
R0973:Sri UTSW 5 8059381 missense probably damaging 1.00
R0974:Sri UTSW 5 8059381 missense probably damaging 1.00
R1187:Sri UTSW 5 8059416 missense probably damaging 1.00
R2860:Sri UTSW 5 8067540 missense probably benign 0.26
R2861:Sri UTSW 5 8067540 missense probably benign 0.26
R3844:Sri UTSW 5 8064576 missense probably damaging 1.00
R4345:Sri UTSW 5 8059427 splice site probably null
R4575:Sri UTSW 5 8063693 missense probably damaging 1.00
R4704:Sri UTSW 5 8062430 splice site probably null
R5878:Sri UTSW 5 8059353 missense probably damaging 1.00
R6257:Sri UTSW 5 8059596 intron probably null
R6944:Sri UTSW 5 8063365 missense probably benign 0.09
X0061:Sri UTSW 5 8063368 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGTGCTCCTGGAAGATAGCCTCTC -3'
(R):5'- AGCATGTGTGAGCCCTTTGTAGCC -3'

Sequencing Primer
(F):5'- cctctcccccctccctc -3'
(R):5'- GAGCCCTTTGTAGCCCTAGC -3'
Posted On2013-10-16