Incidental Mutation 'R0847:Abcb1b'
ID77007
Institutional Source Beutler Lab
Gene Symbol Abcb1b
Ensembl Gene ENSMUSG00000028970
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 1B
SynonymsPgy-1, Abcb1, Mdr1, mdr, Pgy1, Mdr1b
MMRRC Submission 039026-MU
Accession Numbers

Genbank: NM_011075; MGI: 97568  

Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R0847 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8798147-8866315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8845764 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 899 (I899T)
Ref Sequence ENSEMBL: ENSMUSP00000009058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009058] [ENSMUST00000199955]
Predicted Effect probably damaging
Transcript: ENSMUST00000009058
AA Change: I899T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000009058
Gene: ENSMUSG00000028970
AA Change: I899T

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 342 1.4e-96 PFAM
AAA 418 610 4.32e-21 SMART
Pfam:ABC_membrane 709 984 1.9e-75 PFAM
AAA 1060 1248 4.13e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197961
Predicted Effect probably benign
Transcript: ENSMUST00000199955
SMART Domains Protein: ENSMUSP00000143766
Gene: ENSMUSG00000028970

DomainStartEndE-ValueType
PDB:4M2T|B 1 78 2e-26 PDB
Blast:AAA 33 78 2e-11 BLAST
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene encodes a membrane glycoprotein which confers a multidrug-resistance phenotype. The protein encoded by the human gene is an ATP-dependent drug efflux pump for xenobiotic compounds which is responsible for decreased drug accumulation in multidrug-resistant cells and mediates the development of resistance to anticancer drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are hypersensitive to effects of drugs transported by phosphoglycoproteins. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(2) Gene trapped(8)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Abcb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Abcb1b APN 5 8827704 missense probably benign 0.34
IGL00979:Abcb1b APN 5 8825293 splice site probably benign
IGL02157:Abcb1b APN 5 8805487 splice site probably benign
IGL02478:Abcb1b APN 5 8806018 missense probably damaging 0.98
IGL03174:Abcb1b APN 5 8827752 missense probably benign 0.03
IGL03189:Abcb1b APN 5 8845814 missense probably benign
IGL03195:Abcb1b APN 5 8853607 missense possibly damaging 0.83
PIT4283001:Abcb1b UTSW 5 8813693 missense probably damaging 1.00
R0049:Abcb1b UTSW 5 8825661 missense probably damaging 1.00
R0166:Abcb1b UTSW 5 8853468 missense probably damaging 1.00
R0254:Abcb1b UTSW 5 8827409 missense probably benign
R0319:Abcb1b UTSW 5 8827428 missense probably benign 0.01
R0358:Abcb1b UTSW 5 8821423 missense probably benign 0.16
R0365:Abcb1b UTSW 5 8806009 missense probably damaging 1.00
R0408:Abcb1b UTSW 5 8853446 missense probably damaging 0.98
R0521:Abcb1b UTSW 5 8864238 missense probably damaging 1.00
R0533:Abcb1b UTSW 5 8864113 critical splice acceptor site probably null
R1037:Abcb1b UTSW 5 8825657 missense probably benign 0.03
R1432:Abcb1b UTSW 5 8837771 missense possibly damaging 0.69
R1437:Abcb1b UTSW 5 8821436 missense possibly damaging 0.90
R1520:Abcb1b UTSW 5 8814768 missense probably damaging 1.00
R1686:Abcb1b UTSW 5 8798782 missense probably damaging 0.97
R1700:Abcb1b UTSW 5 8849537 missense probably benign 0.44
R1973:Abcb1b UTSW 5 8812746 missense probably benign 0.01
R1993:Abcb1b UTSW 5 8821322 missense possibly damaging 0.61
R2157:Abcb1b UTSW 5 8824791 missense probably benign 0.37
R2207:Abcb1b UTSW 5 8824803 missense probably benign 0.23
R2968:Abcb1b UTSW 5 8861485 missense probably damaging 1.00
R3858:Abcb1b UTSW 5 8813581 missense probably benign 0.11
R4223:Abcb1b UTSW 5 8813722 missense probably damaging 0.97
R4379:Abcb1b UTSW 5 8865875 missense probably benign 0.00
R4674:Abcb1b UTSW 5 8810615 missense probably benign
R4964:Abcb1b UTSW 5 8812671 missense probably benign 0.00
R4964:Abcb1b UTSW 5 8861602 missense probably damaging 1.00
R5167:Abcb1b UTSW 5 8812656 missense probably damaging 0.98
R5216:Abcb1b UTSW 5 8813705 missense probably benign 0.04
R5328:Abcb1b UTSW 5 8837694 missense possibly damaging 0.69
R5391:Abcb1b UTSW 5 8805481 missense probably null 0.00
R5399:Abcb1b UTSW 5 8827410 missense probably benign
R6047:Abcb1b UTSW 5 8806066 missense probably damaging 1.00
R6157:Abcb1b UTSW 5 8824245 missense possibly damaging 0.81
R6293:Abcb1b UTSW 5 8853493 missense probably benign 0.05
R6493:Abcb1b UTSW 5 8824698 missense probably damaging 1.00
R6593:Abcb1b UTSW 5 8853491 missense probably benign
R6799:Abcb1b UTSW 5 8812656 missense probably damaging 0.98
R6944:Abcb1b UTSW 5 8813693 missense probably damaging 1.00
R7028:Abcb1b UTSW 5 8805441 missense probably damaging 0.99
R7227:Abcb1b UTSW 5 8825593 missense probably damaging 1.00
X0025:Abcb1b UTSW 5 8824515 missense possibly damaging 0.91
X0061:Abcb1b UTSW 5 8864269 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGTGCAGGAAATTTGTGGATCTTCCTTA -3'
(R):5'- GTCCCAACTGGATACCAGAGGCATTA -3'

Sequencing Primer
(F):5'- GTGGATCTTCCTTACAGATTTCAAG -3'
(R):5'- GTCACAGATGCTTCTGACTAAACTC -3'
Posted On2013-10-16