Incidental Mutation 'R0847:Fxyd7'
ID77014
Institutional Source Beutler Lab
Gene Symbol Fxyd7
Ensembl Gene ENSMUSG00000036578
Gene NameFXYD domain-containing ion transport regulator 7
Synonyms
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R0847 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location31042513-31051467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31044604 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 60 (C60R)
Ref Sequence ENSEMBL: ENSMUSP00000146171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009831] [ENSMUST00000073892] [ENSMUST00000159753] [ENSMUST00000159924] [ENSMUST00000160689] [ENSMUST00000161684] [ENSMUST00000161805] [ENSMUST00000162087] [ENSMUST00000162116] [ENSMUST00000162733] [ENSMUST00000202395] [ENSMUST00000206341]
Predicted Effect probably benign
Transcript: ENSMUST00000009831
SMART Domains Protein: ENSMUSP00000009831
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 176 8.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073892
AA Change: C63R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073555
Gene: ENSMUSG00000036578
AA Change: C63R

DomainStartEndE-ValueType
Pfam:ATP1G1_PLM_MAT8 13 60 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159753
SMART Domains Protein: ENSMUSP00000123813
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159924
SMART Domains Protein: ENSMUSP00000124219
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160006
Predicted Effect probably benign
Transcript: ENSMUST00000160689
SMART Domains Protein: ENSMUSP00000125187
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161259
Predicted Effect probably benign
Transcript: ENSMUST00000161684
SMART Domains Protein: ENSMUSP00000125285
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161805
SMART Domains Protein: ENSMUSP00000125398
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162087
SMART Domains Protein: ENSMUSP00000125065
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 174 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162116
SMART Domains Protein: ENSMUSP00000124203
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162733
SMART Domains Protein: ENSMUSP00000125173
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 131 167 6.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184636
Predicted Effect probably benign
Transcript: ENSMUST00000202395
SMART Domains Protein: ENSMUSP00000144377
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000206341
AA Change: C60R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This reference sequence was derived from multiple replicate ESTs and validated by similar human genomic sequence. This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. This gene product, FXYD7, is novel and has not been characterized as a protein. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Dec 2000]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Fxyd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Fxyd7 APN 7 31047374 nonsense probably null
IGL02170:Fxyd7 APN 7 31045007 missense possibly damaging 0.91
IGL03218:Fxyd7 APN 7 31044570 critical splice donor site probably null
R0116:Fxyd7 UTSW 7 31047368 splice site probably null
R4299:Fxyd7 UTSW 7 31044982 missense probably benign 0.36
R4950:Fxyd7 UTSW 7 31047390 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCGAGGCTTGCATTTCTTTAGGAC -3'
(R):5'- ATCATCCTGAGTAAGTGCCCTCCC -3'

Sequencing Primer
(F):5'- ATTTCTGGAACTCTCCCTCTGTG -3'
(R):5'- TATCCCCACTGGTAAAGATCCTG -3'
Posted On2013-10-16