Incidental Mutation 'R0847:Sacm1l'
ID77022
Institutional Source Beutler Lab
Gene Symbol Sacm1l
Ensembl Gene ENSMUSG00000025240
Gene NameSAC1 suppressor of actin mutations 1-like (yeast)
SynonymsSAC1, Sac1p
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R0847 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123529759-123592600 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123548862 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 69 (G69D)
Ref Sequence ENSEMBL: ENSMUSP00000026270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026270] [ENSMUST00000217045]
Predicted Effect probably damaging
Transcript: ENSMUST00000026270
AA Change: G69D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026270
Gene: ENSMUSG00000025240
AA Change: G69D

DomainStartEndE-ValueType
Pfam:Syja_N 58 346 4.7e-88 PFAM
low complexity region 400 415 N/A INTRINSIC
Blast:IPPc 416 500 3e-12 BLAST
transmembrane domain 521 543 N/A INTRINSIC
transmembrane domain 550 569 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000217045
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is localized to the endoplasmic reticulum and golgi, and functions as a phosphoinositide lipid phosphatase. Studies in mammals suggest that this gene is involved in the organization of golgi membranes and the mitotic spindles. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Sacm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Sacm1l APN 9 123570549 missense possibly damaging 0.88
IGL02598:Sacm1l APN 9 123578996 missense probably benign 0.03
IGL02796:Sacm1l UTSW 9 123548924 missense possibly damaging 0.66
R0138:Sacm1l UTSW 9 123548917 missense probably benign 0.15
R0628:Sacm1l UTSW 9 123548995 splice site probably benign
R1102:Sacm1l UTSW 9 123582298 missense probably damaging 0.98
R1159:Sacm1l UTSW 9 123566411 missense probably benign 0.06
R2898:Sacm1l UTSW 9 123560601 critical splice donor site probably null
R3001:Sacm1l UTSW 9 123585084 splice site probably benign
R3780:Sacm1l UTSW 9 123552790 missense probably benign 0.00
R3852:Sacm1l UTSW 9 123587576 missense probably damaging 1.00
R4731:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4732:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4733:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4894:Sacm1l UTSW 9 123582344 missense probably benign 0.17
R5021:Sacm1l UTSW 9 123582328 missense probably damaging 1.00
R5033:Sacm1l UTSW 9 123586399 missense probably damaging 1.00
R5075:Sacm1l UTSW 9 123582262 missense probably benign 0.00
R5135:Sacm1l UTSW 9 123577025 missense probably benign 0.00
R5284:Sacm1l UTSW 9 123586420 missense probably damaging 0.99
R5514:Sacm1l UTSW 9 123586354 nonsense probably null
R5629:Sacm1l UTSW 9 123566399 missense probably benign
R6137:Sacm1l UTSW 9 123569005 missense probably damaging 1.00
R6266:Sacm1l UTSW 9 123542420 missense probably damaging 1.00
R7079:Sacm1l UTSW 9 123569997 missense probably damaging 1.00
R7147:Sacm1l UTSW 9 123568951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCTACTCTCACCAGCTAAGCTCAA -3'
(R):5'- tctccggtcccTTAAAGAGTATCTCCA -3'

Sequencing Primer
(F):5'- ACCAGCTAAGCTCAACTCTTTG -3'
(R):5'- AACCCCCTACTGTGTGGC -3'
Posted On2013-10-16