Incidental Mutation 'R0847:Sobp'
ID77023
Institutional Source Beutler Lab
Gene Symbol Sobp
Ensembl Gene ENSMUSG00000038248
Gene Namesine oculis binding protein
Synonyms2900009C16Rik, jc, 5330439J01Rik, Jxc1
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.632) question?
Stock #R0847 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location43002500-43174530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 43022419 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 390 (R390P)
Ref Sequence ENSEMBL: ENSMUSP00000040072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040275]
Predicted Effect probably damaging
Transcript: ENSMUST00000040275
AA Change: R390P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040072
Gene: ENSMUSG00000038248
AA Change: R390P

DomainStartEndE-ValueType
low complexity region 125 139 N/A INTRINSIC
internal_repeat_1 149 201 2.34e-5 PROSPERO
Pfam:SOBP 224 543 1.5e-88 PFAM
low complexity region 565 583 N/A INTRINSIC
low complexity region 590 603 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
low complexity region 725 747 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear zinc finger protein that is involved in development of the cochlea. Defects in this gene have also been linked to intellectual disability. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant mice exhibit open-field hyperactivity and circling behavior from weaning. Their hearing thresholds are elevated at all frequencies; the hearing impairment does not progress over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Sobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Sobp APN 10 43022878 missense probably damaging 1.00
IGL02112:Sobp APN 10 43021877 missense probably benign 0.07
R0071:Sobp UTSW 10 43157997 missense probably damaging 1.00
R0071:Sobp UTSW 10 43157997 missense probably damaging 1.00
R0602:Sobp UTSW 10 43022389 missense probably damaging 1.00
R0792:Sobp UTSW 10 43022693 missense probably damaging 0.99
R0948:Sobp UTSW 10 43022209 missense probably damaging 1.00
R1298:Sobp UTSW 10 43022335 missense probably damaging 1.00
R1484:Sobp UTSW 10 43160831 missense probably damaging 1.00
R1486:Sobp UTSW 10 43022522 missense probably benign 0.42
R1543:Sobp UTSW 10 43021724 missense probably damaging 0.97
R1571:Sobp UTSW 10 43157946 missense possibly damaging 0.93
R1807:Sobp UTSW 10 43160826 missense possibly damaging 0.79
R2198:Sobp UTSW 10 43022524 missense possibly damaging 0.81
R2316:Sobp UTSW 10 43158038 missense possibly damaging 0.75
R4165:Sobp UTSW 10 43021648 missense probably damaging 1.00
R4235:Sobp UTSW 10 43022900 missense probably damaging 1.00
R4378:Sobp UTSW 10 43021304 missense probably damaging 0.97
R4587:Sobp UTSW 10 43158024 missense probably damaging 1.00
R5108:Sobp UTSW 10 43160819 missense probably damaging 1.00
R6165:Sobp UTSW 10 43022603 missense probably damaging 1.00
R7069:Sobp UTSW 10 43021440 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TTCATCATCTGGGGAACCGGCATC -3'
(R):5'- ACACTGCCAACTGCTCTGTCAC -3'

Sequencing Primer
(F):5'- TGGCATCATGCTAACCGGAG -3'
(R):5'- GCCAACTGCTCTGTCACTAAAATC -3'
Posted On2013-10-16