Incidental Mutation 'R0847:Olfr810'
ID77027
Institutional Source Beutler Lab
Gene Symbol Olfr810
Ensembl Gene ENSMUSG00000069421
Gene Nameolfactory receptor 810
SynonymsMOR113-4, GA_x6K02T2PULF-11470271-11469333
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0847 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129787289-129794917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129791458 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 44 (I44F)
Ref Sequence ENSEMBL: ENSMUSP00000150364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091986] [ENSMUST00000214206] [ENSMUST00000214878] [ENSMUST00000217283]
Predicted Effect probably damaging
Transcript: ENSMUST00000091986
AA Change: I44F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089612
Gene: ENSMUSG00000069421
AA Change: I44F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 7.3e-50 PFAM
Pfam:7tm_1 39 288 5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214206
AA Change: I44F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214878
AA Change: I44F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217283
AA Change: I44F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Olfr810
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Olfr810 APN 10 129791319 missense probably damaging 0.98
IGL02365:Olfr810 APN 10 129791535 missense possibly damaging 0.81
IGL02508:Olfr810 APN 10 129790791 missense probably benign 0.44
R0638:Olfr810 UTSW 10 129791232 missense probably damaging 1.00
R0680:Olfr810 UTSW 10 129790818 missense probably damaging 1.00
R1449:Olfr810 UTSW 10 129790854 missense probably damaging 1.00
R1776:Olfr810 UTSW 10 129791131 missense probably benign 0.00
R1938:Olfr810 UTSW 10 129790890 missense probably damaging 1.00
R3836:Olfr810 UTSW 10 129791170 missense probably benign 0.01
R4521:Olfr810 UTSW 10 129791181 missense possibly damaging 0.58
R4816:Olfr810 UTSW 10 129791439 missense probably damaging 1.00
R6287:Olfr810 UTSW 10 129791385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTCAAGCCTAACAGCAGTGGTG -3'
(R):5'- TGCGAACAGTCAGAGGTTCACAATG -3'

Sequencing Primer
(F):5'- GCTTGCAGATGGCTACATATC -3'
(R):5'- GAGGTTCACAATGAAGAACCATAC -3'
Posted On2013-10-16